ID: 991413329

View in Genome Browser
Species Human (GRCh38)
Location 5:66366755-66366777
Sequence CATCCCGTGATAGGATTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991413329_991413340 26 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413340 5:66366804-66366826 GGCTATGGGGTCAAAGAGGAGGG No data
991413329_991413334 5 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413334 5:66366783-66366805 CATACAGAAATATGAACAGAGGG No data
991413329_991413333 4 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413333 5:66366782-66366804 CCATACAGAAATATGAACAGAGG No data
991413329_991413339 25 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413339 5:66366803-66366825 GGGCTATGGGGTCAAAGAGGAGG No data
991413329_991413335 11 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413335 5:66366789-66366811 GAAATATGAACAGAGGGCTATGG No data
991413329_991413338 22 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413338 5:66366800-66366822 AGAGGGCTATGGGGTCAAAGAGG No data
991413329_991413336 12 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG No data
991413329_991413337 13 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413337 5:66366791-66366813 AATATGAACAGAGGGCTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991413329 Original CRISPR CATCCCGTGATAGGATTTAA GGG (reversed) Intergenic
No off target data available for this crispr