ID: 991413330

View in Genome Browser
Species Human (GRCh38)
Location 5:66366756-66366778
Sequence TCATCCCGTGATAGGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991413330_991413333 3 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413333 5:66366782-66366804 CCATACAGAAATATGAACAGAGG No data
991413330_991413334 4 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413334 5:66366783-66366805 CATACAGAAATATGAACAGAGGG No data
991413330_991413335 10 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413335 5:66366789-66366811 GAAATATGAACAGAGGGCTATGG No data
991413330_991413338 21 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413338 5:66366800-66366822 AGAGGGCTATGGGGTCAAAGAGG No data
991413330_991413337 12 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413337 5:66366791-66366813 AATATGAACAGAGGGCTATGGGG No data
991413330_991413336 11 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG No data
991413330_991413340 25 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413340 5:66366804-66366826 GGCTATGGGGTCAAAGAGGAGGG No data
991413330_991413339 24 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413339 5:66366803-66366825 GGGCTATGGGGTCAAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991413330 Original CRISPR TCATCCCGTGATAGGATTTA AGG (reversed) Intergenic
No off target data available for this crispr