ID: 991413336

View in Genome Browser
Species Human (GRCh38)
Location 5:66366790-66366812
Sequence AAATATGAACAGAGGGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991413329_991413336 12 Left 991413329 5:66366755-66366777 CCCTTAAATCCTATCACGGGATG No data
Right 991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG No data
991413330_991413336 11 Left 991413330 5:66366756-66366778 CCTTAAATCCTATCACGGGATGA No data
Right 991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG No data
991413331_991413336 3 Left 991413331 5:66366764-66366786 CCTATCACGGGATGAGCACCATA No data
Right 991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991413336 Original CRISPR AAATATGAACAGAGGGCTAT GGG Intergenic
No off target data available for this crispr