ID: 991414772

View in Genome Browser
Species Human (GRCh38)
Location 5:66380493-66380515
Sequence TTGGCTATTCAGATCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991414772_991414778 30 Left 991414772 5:66380493-66380515 CCCTGTCTGATCTGAATAGCCAA No data
Right 991414778 5:66380546-66380568 CAATAGCTTTACTGTTTGCCTGG No data
991414772_991414777 6 Left 991414772 5:66380493-66380515 CCCTGTCTGATCTGAATAGCCAA No data
Right 991414777 5:66380522-66380544 GGAACAGGAGTAAAGTTGTGAGG No data
991414772_991414775 -9 Left 991414772 5:66380493-66380515 CCCTGTCTGATCTGAATAGCCAA No data
Right 991414775 5:66380507-66380529 AATAGCCAAAACACTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991414772 Original CRISPR TTGGCTATTCAGATCAGACA GGG (reversed) Intergenic
No off target data available for this crispr