ID: 991420028

View in Genome Browser
Species Human (GRCh38)
Location 5:66431296-66431318
Sequence ATCCCCACCAACACTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991420022_991420028 8 Left 991420022 5:66431265-66431287 CCAGTCAAACACCATAGAAAACT No data
Right 991420028 5:66431296-66431318 ATCCCCACCAACACTAGAGAAGG No data
991420020_991420028 15 Left 991420020 5:66431258-66431280 CCCTATTCCAGTCAAACACCATA No data
Right 991420028 5:66431296-66431318 ATCCCCACCAACACTAGAGAAGG No data
991420021_991420028 14 Left 991420021 5:66431259-66431281 CCTATTCCAGTCAAACACCATAG No data
Right 991420028 5:66431296-66431318 ATCCCCACCAACACTAGAGAAGG No data
991420019_991420028 29 Left 991420019 5:66431244-66431266 CCTAGCAATAGCTGCCCTATTCC No data
Right 991420028 5:66431296-66431318 ATCCCCACCAACACTAGAGAAGG No data
991420024_991420028 -3 Left 991420024 5:66431276-66431298 CCATAGAAAACTATGGCCCCATC No data
Right 991420028 5:66431296-66431318 ATCCCCACCAACACTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991420028 Original CRISPR ATCCCCACCAACACTAGAGA AGG Intergenic
No off target data available for this crispr