ID: 991421882

View in Genome Browser
Species Human (GRCh38)
Location 5:66450575-66450597
Sequence AAAAGCTGGCTGGCCAAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991421882_991421885 1 Left 991421882 5:66450575-66450597 CCGATCTTGGCCAGCCAGCTTTT No data
Right 991421885 5:66450599-66450621 CTCCCCCAAAAGAGTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991421882 Original CRISPR AAAAGCTGGCTGGCCAAGAT CGG (reversed) Intergenic
No off target data available for this crispr