ID: 991422955

View in Genome Browser
Species Human (GRCh38)
Location 5:66460045-66460067
Sequence GTGTAGGCAGAGATTAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991422945_991422955 20 Left 991422945 5:66460002-66460024 CCCTCAACTCCTTCCATGAACTG No data
Right 991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG No data
991422944_991422955 21 Left 991422944 5:66460001-66460023 CCCCTCAACTCCTTCCATGAACT No data
Right 991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG No data
991422943_991422955 24 Left 991422943 5:66459998-66460020 CCTCCCCTCAACTCCTTCCATGA No data
Right 991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG No data
991422949_991422955 7 Left 991422949 5:66460015-66460037 CCATGAACTGTGGCCTCAGAAAA No data
Right 991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG No data
991422950_991422955 -6 Left 991422950 5:66460028-66460050 CCTCAGAAAAGCTCAGAGTGTAG No data
Right 991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG No data
991422946_991422955 19 Left 991422946 5:66460003-66460025 CCTCAACTCCTTCCATGAACTGT No data
Right 991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG No data
991422948_991422955 11 Left 991422948 5:66460011-66460033 CCTTCCATGAACTGTGGCCTCAG No data
Right 991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991422955 Original CRISPR GTGTAGGCAGAGATTAGGGA GGG Intergenic
No off target data available for this crispr