ID: 991425511

View in Genome Browser
Species Human (GRCh38)
Location 5:66487909-66487931
Sequence CAGAGTATAAATCCTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991425511_991425513 6 Left 991425511 5:66487909-66487931 CCAGCAACAGGATTTATACTCTG No data
Right 991425513 5:66487938-66487960 CAGATTAAAAGATTCTTCCCTGG No data
991425511_991425515 8 Left 991425511 5:66487909-66487931 CCAGCAACAGGATTTATACTCTG No data
Right 991425515 5:66487940-66487962 GATTAAAAGATTCTTCCCTGGGG No data
991425511_991425514 7 Left 991425511 5:66487909-66487931 CCAGCAACAGGATTTATACTCTG No data
Right 991425514 5:66487939-66487961 AGATTAAAAGATTCTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991425511 Original CRISPR CAGAGTATAAATCCTGTTGC TGG (reversed) Intergenic
No off target data available for this crispr