ID: 991430614

View in Genome Browser
Species Human (GRCh38)
Location 5:66541061-66541083
Sequence GAGATTTAGCAGAACGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991430614_991430616 -8 Left 991430614 5:66541061-66541083 CCAGCCTCGTTCTGCTAAATCTC No data
Right 991430616 5:66541076-66541098 TAAATCTCCCACCCATGACTTGG No data
991430614_991430622 27 Left 991430614 5:66541061-66541083 CCAGCCTCGTTCTGCTAAATCTC No data
Right 991430622 5:66541111-66541133 TCCGCACCTCCTCAGGTTTGAGG No data
991430614_991430621 20 Left 991430614 5:66541061-66541083 CCAGCCTCGTTCTGCTAAATCTC No data
Right 991430621 5:66541104-66541126 CTTTGCATCCGCACCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991430614 Original CRISPR GAGATTTAGCAGAACGAGGC TGG (reversed) Intergenic
No off target data available for this crispr