ID: 991432093

View in Genome Browser
Species Human (GRCh38)
Location 5:66559024-66559046
Sequence ATAGCTAGGGGACCTTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991432093_991432099 8 Left 991432093 5:66559024-66559046 CCCAGAAAAGGTCCCCTAGCTAT No data
Right 991432099 5:66559055-66559077 AGCCGTTGCTCACCAATATGTGG No data
991432093_991432102 29 Left 991432093 5:66559024-66559046 CCCAGAAAAGGTCCCCTAGCTAT No data
Right 991432102 5:66559076-66559098 GGCATGTCCCAGTTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991432093 Original CRISPR ATAGCTAGGGGACCTTTTCT GGG (reversed) Intergenic
No off target data available for this crispr