ID: 991432484

View in Genome Browser
Species Human (GRCh38)
Location 5:66562725-66562747
Sequence TCTCCTAGATGGGTTTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991432484_991432494 27 Left 991432484 5:66562725-66562747 CCTTGAAAAACCCATCTAGGAGA No data
Right 991432494 5:66562775-66562797 TGAGGGGAAAGTGCTGTTTCCGG No data
991432484_991432491 11 Left 991432484 5:66562725-66562747 CCTTGAAAAACCCATCTAGGAGA No data
Right 991432491 5:66562759-66562781 ATCACTTCCAGCTACCTGAGGGG No data
991432484_991432490 10 Left 991432484 5:66562725-66562747 CCTTGAAAAACCCATCTAGGAGA No data
Right 991432490 5:66562758-66562780 AATCACTTCCAGCTACCTGAGGG No data
991432484_991432489 9 Left 991432484 5:66562725-66562747 CCTTGAAAAACCCATCTAGGAGA No data
Right 991432489 5:66562757-66562779 AAATCACTTCCAGCTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991432484 Original CRISPR TCTCCTAGATGGGTTTTTCA AGG (reversed) Intergenic