ID: 991435268

View in Genome Browser
Species Human (GRCh38)
Location 5:66591822-66591844
Sequence CTTTGTCTCCTCAAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991435264_991435268 -2 Left 991435264 5:66591801-66591823 CCTGTCCAGCTGCTAAGCTGTCT No data
Right 991435268 5:66591822-66591844 CTTTGTCTCCTCAAGGTGGTTGG No data
991435265_991435268 -7 Left 991435265 5:66591806-66591828 CCAGCTGCTAAGCTGTCTTTGTC No data
Right 991435268 5:66591822-66591844 CTTTGTCTCCTCAAGGTGGTTGG No data
991435263_991435268 24 Left 991435263 5:66591775-66591797 CCAGCTGTTTTTAGAGCATGCAT No data
Right 991435268 5:66591822-66591844 CTTTGTCTCCTCAAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991435268 Original CRISPR CTTTGTCTCCTCAAGGTGGT TGG Intergenic
No off target data available for this crispr