ID: 991435695 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:66596049-66596071 |
Sequence | CGTCAGAGGGAGACGGCGAG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
991435695_991435703 | 14 | Left | 991435695 | 5:66596049-66596071 | CCGCTCGCCGTCTCCCTCTGACG | No data | ||
Right | 991435703 | 5:66596086-66596108 | AGCCACTCCCCCGCTAAGTTCGG | No data | ||||
991435695_991435709 | 29 | Left | 991435695 | 5:66596049-66596071 | CCGCTCGCCGTCTCCCTCTGACG | No data | ||
Right | 991435709 | 5:66596101-66596123 | AAGTTCGGAGTCTCAGCCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
991435695 | Original CRISPR | CGTCAGAGGGAGACGGCGAG CGG (reversed) | Intergenic | ||
No off target data available for this crispr |