ID: 991435695

View in Genome Browser
Species Human (GRCh38)
Location 5:66596049-66596071
Sequence CGTCAGAGGGAGACGGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991435695_991435703 14 Left 991435695 5:66596049-66596071 CCGCTCGCCGTCTCCCTCTGACG No data
Right 991435703 5:66596086-66596108 AGCCACTCCCCCGCTAAGTTCGG No data
991435695_991435709 29 Left 991435695 5:66596049-66596071 CCGCTCGCCGTCTCCCTCTGACG No data
Right 991435709 5:66596101-66596123 AAGTTCGGAGTCTCAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991435695 Original CRISPR CGTCAGAGGGAGACGGCGAG CGG (reversed) Intergenic
No off target data available for this crispr