ID: 991437476

View in Genome Browser
Species Human (GRCh38)
Location 5:66611437-66611459
Sequence TTCTGTCCTCCTCTCATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991437474_991437476 -4 Left 991437474 5:66611418-66611440 CCTCTTCTCTGCTTCCTCTTTCT 0: 1
1: 1
2: 25
3: 347
4: 2436
Right 991437476 5:66611437-66611459 TTCTGTCCTCCTCTCATGAGAGG 0: 1
1: 0
2: 2
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991437476 Original CRISPR TTCTGTCCTCCTCTCATGAG AGG Intronic
902576713 1:17382575-17382597 TTCAGCCCTCCTCTCCTGGGAGG + Intronic
904926347 1:34051661-34051683 TTGTCTCCTCCTCTGGTGAGGGG + Intronic
905698597 1:39994703-39994725 GTATTTCCTCCTCTCATAAGTGG + Intergenic
905972731 1:42153823-42153845 TTCTGGCCTCCTCCCATGCAAGG - Intronic
906612499 1:47213137-47213159 TTTTGTCTTCCTTTCCTGAGAGG + Intergenic
908752755 1:67440446-67440468 TTCTTTCCTCCTCTCATAAATGG - Intergenic
908977577 1:69917729-69917751 TATTGTCCTACTCTCATGAATGG - Intronic
909322211 1:74303809-74303831 TTTTGACCTCCTCCCATGAATGG - Intronic
912138673 1:106694578-106694600 TTCTGTCTTCCTCTCCTAAATGG + Intergenic
912747559 1:112258027-112258049 CCCTGTACTCCTCTCATGTGTGG + Intergenic
916391169 1:164332495-164332517 TTCAGTTCTCCTCTTATGAAGGG - Intergenic
919234332 1:194819219-194819241 TTCTGTTATCCACTCATAAGAGG - Intergenic
920571735 1:207022905-207022927 TTGGGTCCTCCCCTGATGAGAGG + Exonic
922076942 1:222254157-222254179 TGCACTCCCCCTCTCATGAGGGG + Intergenic
922662318 1:227440929-227440951 TTCTTTCCTGCTCTCTTCAGAGG - Intergenic
1067275031 10:44826665-44826687 GTCTGGCCTCCTCCCCTGAGAGG + Intergenic
1069898235 10:71692101-71692123 TTCTGCCCTCCTCACCTGTGAGG + Intronic
1071162792 10:82770595-82770617 TTCTTTCCTCCTCTGATCTGAGG - Intronic
1074923913 10:118047128-118047150 TGATGACCTCCTCTCACGAGCGG - Intergenic
1076012059 10:126997008-126997030 TTGTGTCCTACAGTCATGAGTGG + Intronic
1077635286 11:3837964-3837986 TTTTGTCCTCATCTCATATGGGG - Intronic
1079685184 11:23350678-23350700 TTCATTCCTCCTGTCATGTGAGG + Intergenic
1080589894 11:33713439-33713461 TCCTGTCCTCCTCCTCTGAGGGG + Intronic
1080780684 11:35427047-35427069 TTCTTTCCTTCTCTCTTGTGTGG + Intergenic
1081348484 11:42019722-42019744 TCCTCTGCTCCCCTCATGAGTGG + Intergenic
1081348486 11:42019731-42019753 TTTTTTTCTCCACTCATGAGGGG - Intergenic
1082819553 11:57535518-57535540 TTCTCTGCACCTCTCATGAGTGG - Intergenic
1087458771 11:98420933-98420955 ATCTGTCCTCCTGTCCTGAAGGG + Intergenic
1087815344 11:102652407-102652429 TGCTGATCTCCTCCCATGAGGGG - Intergenic
1088273542 11:108060251-108060273 TTCTGTACTACTATCATTAGTGG - Intronic
1090945517 11:131426277-131426299 TTCTGTCCTCCTCACTCAAGGGG - Intronic
1091017041 11:132060493-132060515 TGCTGTCCTCCGCTGATGAAAGG + Intronic
1094614717 12:32025827-32025849 GTCTCTAGTCCTCTCATGAGGGG + Intergenic
1095240944 12:39858122-39858144 TTCTGTCCACCTGTCATGGAAGG - Intronic
1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG + Exonic
1098901617 12:76117105-76117127 TTTTGTCCTCCACTCATTAAAGG + Intergenic
1100680374 12:96913243-96913265 TTCTGTCCACCTGTACTGAGGGG + Intronic
1101683642 12:106994803-106994825 TTCTGTCCCTCACTCATGTGTGG + Intronic
1102272727 12:111552389-111552411 TTCTGTACTTTTCTCATGTGCGG + Exonic
1102411675 12:112725587-112725609 CTCTGTCCTCTACTCAGGAGTGG + Intronic
1104301072 12:127565511-127565533 TTTTATCCTCCCCTCAAGAGAGG + Intergenic
1104533159 12:129591711-129591733 TTTTTTCCCCCTCTAATGAGGGG + Intronic
1108725535 13:53176441-53176463 TTCTGTCCTTCTGTCATGTGAGG - Intergenic
1111021693 13:82459311-82459333 ATCTATCCTCCTCTCCTGAAGGG - Intergenic
1111466799 13:88623645-88623667 TTGTGTGCTGCTCTCATGAATGG + Intergenic
1116205155 14:41856089-41856111 TTCAGTAGTCCTTTCATGAGAGG + Intronic
1122715298 14:103693321-103693343 TTCTTTCCTCTTGTCATTAGGGG - Intergenic
1126931111 15:53652383-53652405 CTCTCTTCTCCTCTGATGAGAGG + Intronic
1127457077 15:59164984-59165006 TTCTGTCATTCTCCCATGTGAGG + Intronic
1127606204 15:60591454-60591476 TTCTCTCCTTCTCACCTGAGAGG + Intronic
1129252541 15:74316735-74316757 CTCTGTGCAACTCTCATGAGGGG - Intronic
1130882069 15:88063795-88063817 TTCTTTTCTCCTGTCATGAAAGG + Intronic
1132194240 15:99898318-99898340 TCCTGTGCTGTTCTCATGAGAGG - Intergenic
1135057535 16:19243059-19243081 TTCTGTCCTGCTCTAATGCAGGG - Intronic
1135735906 16:24931517-24931539 TCCTGACCACCTCTCATCAGAGG - Intronic
1137244471 16:46690824-46690846 TTCTGTCTTCCTCTCACCAGAGG + Intronic
1141572214 16:84941044-84941066 TCCTGGCCGCCTCTCAGGAGGGG - Intergenic
1142544378 17:689157-689179 TTCTCTCATCCTCTCTTGGGAGG - Intronic
1142949566 17:3466749-3466771 TTCCGTCCTTCTGTCATGTGAGG - Intronic
1146317673 17:31820931-31820953 CTCTTTCCTCTTCTCTTGAGAGG - Intergenic
1146817022 17:35950478-35950500 CTTTGTCCTCCTGTCATGGGCGG - Intergenic
1147335330 17:39724025-39724047 TCCTGTCCTCCTAGCAGGAGAGG - Intronic
1147877500 17:43632111-43632133 TCCTTTCCTCCTCTCCTGAGGGG - Intergenic
1149422144 17:56521428-56521450 CTCTGACCTCCCATCATGAGAGG - Intergenic
1149868944 17:60165971-60165993 TTCAGTCTTCCTCTTATAAGTGG - Intronic
1150647163 17:66986148-66986170 TTCTGGCCTCCTCTCATAAGAGG - Intronic
1150975430 17:70080741-70080763 TGCTCTCCTCATCTCATGTGAGG + Intronic
1151697654 17:75726061-75726083 TTCTGTCCTTCTGGCTTGAGTGG + Intronic
1153141964 18:1983043-1983065 TTCTGTCCCCCTCTAATGCTGGG - Intergenic
1153239287 18:3015884-3015906 CTCTCTCCTCCCCTCATTAGTGG + Intergenic
1153438288 18:5089515-5089537 ATCTGTCCTCCTGTCCTGAAGGG - Intergenic
1156671262 18:39472923-39472945 TGCTTTTCCCCTCTCATGAGCGG + Intergenic
1157309961 18:46545463-46545485 CTCTTTCCTCCTTTCATGAAAGG - Intronic
1159486728 18:69070102-69070124 TTCTCTCCTCCTCTTCTGACAGG + Intergenic
1161773235 19:6242617-6242639 TTCTCTCCTGCTCTCAGGACGGG + Intronic
1164063339 19:21693972-21693994 TCCTGTCACCCACTCATGAGAGG - Intergenic
1164732103 19:30514156-30514178 GTCTGTGCTCCTCTCCTTAGGGG - Intronic
1164908973 19:31990167-31990189 TTCTCTCCTACTGTCATGACAGG + Intergenic
1165001918 19:32771125-32771147 TTCTCTCTTCCTCTCTTGACAGG - Intronic
1165711513 19:38014368-38014390 CTCTGTGCTGGTCTCATGAGTGG - Intronic
1166251751 19:41576237-41576259 CTCTGTCCTCCTCTGTGGAGAGG - Exonic
1166313310 19:41975464-41975486 TTCTGTCTTCCTCCCCTGTGGGG - Intronic
1167163968 19:47785519-47785541 TTCTGTCCTCCCAGAATGAGTGG - Intergenic
1168123756 19:54271409-54271431 ATCTGTCCTCATCTCATCAAGGG + Intronic
1168173579 19:54607395-54607417 TCCTGTCCTCTTCTCATTAAGGG - Intronic
1168178598 19:54644112-54644134 ATCTGTCCTCATCTCATCAAGGG - Intronic
929735566 2:44545191-44545213 TTGTGTCCTGCTCTTAGGAGAGG + Intronic
930479841 2:51933792-51933814 TTCTGTCCACATTTCACGAGAGG - Intergenic
931087377 2:58847819-58847841 TTCTATCCTCCTCGTATGAATGG - Intergenic
933989676 2:87625250-87625272 TTCTGTCATCCCTTCAAGAGTGG - Intergenic
934170464 2:89537116-89537138 ATCTGCCCTCCTGTGATGAGAGG + Intergenic
934280766 2:91611436-91611458 ATCTGCCCTCCTGTGATGAGAGG + Intergenic
935651467 2:105385858-105385880 TCCTGTCCTTCTCTCATTAAAGG + Intronic
936304168 2:111325576-111325598 TTCTGTCATCCCTTCAAGAGTGG + Intergenic
936820836 2:116518610-116518632 TTTTTGCCTCCTTTCATGAGTGG + Intergenic
937614526 2:123905806-123905828 TTCTGTCCTCCTGTAATTAGAGG - Intergenic
939617483 2:144377540-144377562 TTCTGTTGTCCACTCATGGGTGG + Intergenic
940268422 2:151864891-151864913 TTATGTCCTACTCTCAAAAGTGG + Intronic
946342432 2:219079412-219079434 TTCTATTCTTCTCCCATGAGAGG - Intronic
948034097 2:234843778-234843800 TTGTGCTCTCCTCTCATGCGAGG - Intergenic
1169144842 20:3245476-3245498 TTTTGTTTTCCTCTCATGACTGG - Intergenic
1169339016 20:4781974-4781996 TTTTGTCCTGCCCTCTTGAGAGG - Exonic
1169634333 20:7671040-7671062 TTCTGATCTCTTCTCATGATAGG - Intergenic
1169886919 20:10410260-10410282 TTCTGCCTCCCTCACATGAGAGG + Intronic
1170605468 20:17872455-17872477 TTCTGTCGCCCTCTCATAAGTGG - Intergenic
1171100160 20:22375397-22375419 TTTTGTCCTCCTCTCAGGTTTGG + Intergenic
1171132671 20:22668222-22668244 TTCTGTCTTCCTCTGTTGATTGG + Intergenic
1171531587 20:25856808-25856830 TCCTCTCCTCTTCTCATGGGTGG - Intronic
1183174786 22:36215153-36215175 TTTTGTTTTCCTTTCATGAGGGG - Intergenic
1183796124 22:40119639-40119661 TTGTCTCATCATCTCATGAGGGG + Intronic
1184559367 22:45253027-45253049 TTCTGTCCTCTTCTCATGATGGG + Intergenic
1185111329 22:48901754-48901776 TTCTGGCCTCCTCACAGCAGAGG - Intergenic
1185111581 22:48903014-48903036 TTCTGGCCTCCTCACAGCAGAGG + Intergenic
950782537 3:15404295-15404317 TCCTGTCCTCCTCAAATGTGTGG - Intronic
951985262 3:28612792-28612814 TTCTGTCCTTCTGCCATGGGAGG - Intergenic
954594267 3:51811980-51812002 TTTTGCCCTTCTCTCATGCGAGG - Intergenic
955210874 3:56939795-56939817 ATCTGTCCTCCTATCATAAAAGG - Intronic
956349041 3:68313685-68313707 TTCTGTACTCTTTTCAGGAGAGG - Intronic
956870739 3:73415163-73415185 TTCTTTCCTTCTCTCAGTAGTGG - Intronic
959741785 3:109729123-109729145 TACTGACCTCCTCTCCAGAGAGG + Intergenic
965704406 3:171491387-171491409 TTCAGTTTTCCTATCATGAGTGG + Intergenic
966927285 3:184653044-184653066 TCCTCTCCTTCTCTCATAAGAGG - Intronic
970534676 4:17018516-17018538 TTCTGTCATCATCACATAAGGGG + Intergenic
970918660 4:21367029-21367051 TTCTGCCCTCCTGCCATGTGAGG + Intronic
970948724 4:21727264-21727286 TTCTGTCCTTCTACCATGTGAGG + Intronic
972979932 4:44684993-44685015 TTCTGTTCTCTTCTTATTAGAGG - Intronic
976124065 4:81814850-81814872 TTCCATCCTGCTCTCCTGAGAGG - Intronic
976269700 4:83218572-83218594 CTCTGTCCTTCTCTCTGGAGGGG + Intergenic
976988195 4:91328353-91328375 TTCTTTCCTGCTCTGATGTGAGG - Intronic
978536557 4:109769469-109769491 TGCTTTCCACCTCTCAGGAGAGG + Intronic
979669303 4:123345318-123345340 TTCTGTCCTCCTCCTCTTAGAGG - Intergenic
981422005 4:144561888-144561910 TTTGTTCCTCCTCCCATGAGAGG + Intergenic
981488285 4:145311718-145311740 TGGTGTCTTCCTCTCATGACTGG + Intergenic
983476976 4:168225218-168225240 TTCTGTCACTCTCTCTTGAGAGG - Intronic
984453999 4:179941858-179941880 TTGAGTCCTCCTTTCATGAAAGG + Intergenic
985372018 4:189295697-189295719 TTCTATGCTCATCACATGAGAGG + Intergenic
986055582 5:4133659-4133681 TCCTGTCCTCCACGCAAGAGAGG + Intergenic
986342760 5:6805275-6805297 CTCTGTCCTCTTCCCAGGAGGGG + Intergenic
986768254 5:10947840-10947862 TTCTGTCATCCTCTCTGGAATGG + Intergenic
991437476 5:66611437-66611459 TTCTGTCCTCCTCTCATGAGAGG + Intronic
992961773 5:81962901-81962923 TTCAGTCTTCCTCATATGAGGGG - Intergenic
997430141 5:133831987-133832009 AAGTGTCCTCATCTCATGAGAGG + Intergenic
998885083 5:146685755-146685777 TTCTGTCCTCCTGTCAGCACAGG - Intronic
999101390 5:149028606-149028628 TTCTGTCCTCTTGCCAAGAGCGG - Intronic
999228275 5:150045607-150045629 TTCTTCCCACCACTCATGAGAGG + Exonic
1001123823 5:169001579-169001601 TTCTGTCAGCATCTCATGACAGG + Intronic
1003861212 6:10323479-10323501 TTCTGTCATCCCCGCATTAGTGG + Intergenic
1005230494 6:23696417-23696439 CTCTGTTCTCCTCTGATGACAGG - Intergenic
1005282070 6:24284766-24284788 TTCTGCCCTCCTCACATGCCAGG + Intronic
1006295569 6:33168624-33168646 TTCTGTGCCCCACTCCTGAGGGG - Intronic
1007941074 6:45782205-45782227 TGCTGTCCTCCTCTCATTCCGGG - Intergenic
1013176668 6:107683697-107683719 TTCTGTCTGCCTCTCCTGAGAGG + Intergenic
1013292685 6:108732614-108732636 ATCCGGCCTCCTCTCATTAGTGG + Intergenic
1013311622 6:108900221-108900243 ATCTGTCCTACTCTCTTGAAGGG + Intronic
1013327466 6:109061918-109061940 TTCTGTCCTCCACTAAAGTGAGG - Intronic
1014688178 6:124529988-124530010 CTCTGGCCTCTTCTTATGAGAGG - Intronic
1016343405 6:143085822-143085844 ATCTGTCCTCCTGTCCTGAAGGG + Intronic
1016739596 6:147513314-147513336 TGCTGTCCTACTGTCATAAGTGG - Intronic
1016940369 6:149478234-149478256 TTCTGTCGTACACTCAGGAGAGG - Intronic
1019090354 6:169526003-169526025 TTCTGTCCTCCACATATGAGGGG - Intronic
1019683439 7:2366270-2366292 CACTATCCTCCTCTCACGAGAGG - Intronic
1020740409 7:12009274-12009296 TTCTCTCCTCCTCCCACCAGTGG + Intergenic
1020963943 7:14842698-14842720 TTCTGTCCTCCTCTAACCAAAGG + Intronic
1022440440 7:30428701-30428723 CTATGTCCTCCTTTCATGACTGG - Intronic
1023838344 7:44081414-44081436 TGCTATCATCCTCTCCTGAGTGG + Intronic
1024439409 7:49398637-49398659 TTCTATCCTCCTCTCAAGATTGG + Intergenic
1024835448 7:53512971-53512993 TCCTCTCCTCTTCTCATAAGGGG - Intergenic
1027449745 7:78317700-78317722 TTCTGTCGGCCCCTCCTGAGAGG - Intronic
1029169498 7:98620690-98620712 TTCCCTCCTCCTGTCATGGGAGG - Intronic
1031342961 7:120628238-120628260 TACTGTCCTCAACTCACGAGAGG - Intronic
1032427310 7:131832376-131832398 TTCTGTCCTGCTGGCAGGAGTGG + Intergenic
1033546113 7:142401649-142401671 TGCTCTCTTCCTCTCAGGAGGGG + Intergenic
1033647897 7:143319102-143319124 CTCTGTCCTCTTCACATGTGGGG + Intronic
1034778213 7:153851354-153851376 TGCTGTCCTCCTCTCATTCCTGG + Intergenic
1035028093 7:155839559-155839581 TTCTGCCCTCCTGTGATGTGTGG - Intergenic
1036669983 8:10776937-10776959 TTCTGTCCTTCTCTCTTGCCAGG - Intronic
1038517143 8:28196974-28196996 TTCTGGCTTCCTCTCCTGCGTGG - Intergenic
1038583280 8:28768722-28768744 TTCTCTCCTTCACTCTTGAGAGG - Intronic
1038938929 8:32282421-32282443 TACTGTCCGCCTTCCATGAGTGG + Intronic
1039245072 8:35599668-35599690 TTTTGTCTTTCTCTCATGATTGG + Intronic
1041154710 8:54973361-54973383 CTCTTTCCTCCACTCAGGAGAGG - Intergenic
1041745952 8:61209659-61209681 CTCTTTCCTCCTCTCTTCAGAGG - Intronic
1042118351 8:65457258-65457280 TTCTGTACTTATCTCATTAGTGG + Intergenic
1042183963 8:66118829-66118851 TTCTCTCCGCTGCTCATGAGTGG + Intergenic
1043155514 8:76773971-76773993 TTCTGTCCTCCTTTCCAAAGTGG + Intronic
1043327676 8:79072166-79072188 TCCTGTCCTCCTCCCCTGAATGG - Intergenic
1044239259 8:89869571-89869593 TTGTGTCTTGCTTTCATGAGTGG - Intergenic
1049041758 8:140117492-140117514 TTCTGTCTTACTGTCATGTGAGG - Intronic
1049679829 8:143913176-143913198 TGCTCTCCTCTCCTCATGAGAGG - Intergenic
1051389210 9:16545619-16545641 GTCTGTGCTCCACTCATGTGTGG - Intronic
1052732977 9:32311105-32311127 TTCTGTCCTTCCCTCCAGAGTGG - Intergenic
1055325262 9:75121914-75121936 TGCTGTCCCCATCTCCTGAGGGG - Intronic
1056045635 9:82712732-82712754 TTCTGTGCTTCTCTTATCAGTGG - Intergenic
1056740205 9:89247939-89247961 TTCTAACCTCCTCTTATGAATGG + Intergenic
1056956451 9:91085420-91085442 TTCTGTCCTCCTCACTTGCCTGG - Intergenic
1057766515 9:97924429-97924451 TGCTGCCCTCCTCTCATGTTAGG - Intergenic
1060040956 9:120300582-120300604 TTCTCTTCTCCTCCCATGAAAGG + Intergenic
1060486731 9:124052428-124052450 TTCTGTCCCCCTTTCCTGGGTGG - Intergenic
1061213659 9:129207891-129207913 TTCTCTCCACCTCCCTTGAGGGG + Intergenic
1061452500 9:130675973-130675995 TTCTGTGTTCCTCAAATGAGGGG - Intronic
1061569239 9:131466245-131466267 TTCTGCCCTCCTTTCATTAAAGG + Intronic
1061583505 9:131552260-131552282 TTGTGGCCTCCTCACAGGAGGGG - Intergenic
1061711347 9:132490110-132490132 TTCTGTCCGTCTGTCATGCGAGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062733726 9:138122989-138123011 TGCTGTCCTCCTCCCACGAGTGG + Exonic
1189020397 X:37331234-37331256 TGTTCTCTTCCTCTCATGAGGGG - Intergenic
1189250302 X:39595815-39595837 TTCTTTCCTCCTCAAATGACGGG + Intergenic
1190852801 X:54263108-54263130 TCCTCTCCTCCTCCCATTAGTGG + Intronic
1191642326 X:63440272-63440294 TTCTGTCCTCCTCACATTTTTGG - Intergenic
1192776728 X:74253205-74253227 TGCTCTCTCCCTCTCATGAGTGG - Intergenic
1193468271 X:81872235-81872257 TTCAGTTCTCCTCTCTTGACAGG - Intergenic
1193505690 X:82340660-82340682 ATCTGTCCTCTTCCTATGAGAGG - Intergenic
1193979412 X:88162856-88162878 TTATGTCCTCCTATTATCAGTGG + Intergenic
1194080564 X:89458827-89458849 TTTTCTCCTCCTTTCATTAGGGG - Intergenic
1194862003 X:99010927-99010949 TTCTTTCTTCCTTTTATGAGTGG - Intergenic
1195676263 X:107509334-107509356 TTCCTGCCTCCTCTCATGAGAGG + Intergenic
1196441659 X:115724633-115724655 TTCTTTCCTCCTTTCTTGATAGG + Intergenic
1196445189 X:115842622-115842644 TTCTTTCCTCCTTTCTTGATAGG + Intergenic
1201219413 Y:11753726-11753748 CTATGTCCTCCTTTGATGAGAGG + Intergenic