ID: 991438314

View in Genome Browser
Species Human (GRCh38)
Location 5:66618598-66618620
Sequence CTGTCTCCCTTCAATACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991438314_991438317 -5 Left 991438314 5:66618598-66618620 CCCTCTGTATTGAAGGGAGACAG 0: 1
1: 0
2: 1
3: 9
4: 204
Right 991438317 5:66618616-66618638 GACAGACACGCTGGTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991438314 Original CRISPR CTGTCTCCCTTCAATACAGA GGG (reversed) Intronic
900015165 1:143631-143653 CTGTCTCCCATCACCCCAGATGG - Intergenic
902830525 1:19009506-19009528 TTGTCTCTCTTCAAAGCAGATGG + Intergenic
908413079 1:63886018-63886040 CTGTCTCCCATCACCCCAGATGG - Intronic
909579546 1:77218958-77218980 CTGACTCCTATCAAAACAGAGGG + Intronic
910057286 1:83047835-83047857 GTGTTTCCCTTCAATTCATATGG - Intergenic
913484020 1:119317081-119317103 CTGACTCCCGTAAATACTGATGG - Intergenic
913684344 1:121216934-121216956 CTGTATCCCACCAAGACAGATGG + Intronic
914036183 1:144004549-144004571 CTGTATCCCACCAAGACAGATGG + Intergenic
914153274 1:145063396-145063418 CTGTATCCCACCAAGACAGATGG - Intronic
918037833 1:180893088-180893110 CTCTCTCCCTTGAAAAAAGAAGG + Intergenic
918502829 1:185217496-185217518 CTGTCTCCCATCATCCCAGATGG + Intronic
919959956 1:202457048-202457070 GTGTCTATCTTCAATACAGCTGG - Intronic
919988774 1:202694346-202694368 CTTTTTCCCTTCAATATTGAGGG + Intronic
920471653 1:206235447-206235469 CTGTATCCCACCAAGACAGATGG + Intronic
921424669 1:214987711-214987733 ATGTCTCCCTTCATTCCACATGG - Intergenic
921774587 1:219082226-219082248 GTCTTTCCCTTCAATGCAGAGGG + Intergenic
922135478 1:222821202-222821224 CTGTCTCCAATTAATTCAGATGG + Intergenic
922263314 1:223961852-223961874 CTGTCTCCCATCACCCCAGATGG - Intergenic
924345155 1:243066866-243066888 CTGTCTCCCATCACCCCAGATGG - Intergenic
924887395 1:248233974-248233996 CTGGCTCCCTTGGATAAAGAAGG + Intergenic
1065251468 10:23819359-23819381 CTATCTCCCCTGAATTCAGAAGG - Intronic
1065754659 10:28920133-28920155 CTGTCTCCCATCACCCCAGATGG - Intergenic
1066731181 10:38437943-38437965 CTGTCTCCCATCACCCCAGATGG + Intergenic
1067575118 10:47404041-47404063 CTGTCTCCCTCCCATAGAGAAGG - Intergenic
1069080085 10:64079386-64079408 ATGTCTTCCTTCCATATAGAAGG + Intergenic
1071025403 10:81107171-81107193 CTGTCTCCCTGGCATACAGTTGG - Intergenic
1074320397 10:112396833-112396855 CTGTCTTCCTTCACTAGACAAGG + Intronic
1075561777 10:123473510-123473532 CTTTCTCCCTGGAATCCAGAAGG - Intergenic
1079282192 11:19097595-19097617 CTCCCTCCCTTCACTGCAGAAGG + Intergenic
1079301088 11:19279536-19279558 CTGTCTCCACTCACTGCAGAAGG + Intergenic
1080763166 11:35272249-35272271 CTGTATTCCATCAATACAGAAGG + Intronic
1081055686 11:38408132-38408154 CTGTCTCCCTTCAAAAAATTGGG - Intergenic
1082740816 11:56908993-56909015 CTGTCTCCCATCACCCCAGATGG - Intergenic
1083189602 11:61040470-61040492 CATTCTCCCTTAAAAACAGAGGG + Intergenic
1083230326 11:61313511-61313533 ATGTGTCCCCTCAATTCAGATGG - Exonic
1083278704 11:61612083-61612105 CTGTCTTCCTTCTTTTCAGAAGG - Intergenic
1085366145 11:75946974-75946996 CTCTCTCCCTAGCATACAGATGG + Intronic
1085478239 11:76801329-76801351 CTGGCTCCCTGAACTACAGAGGG - Intergenic
1087151620 11:94865335-94865357 CTGTCCCCCTTCACTACCTAAGG + Intronic
1089128315 11:116192934-116192956 CTGTCTCCCTTCCCTCCTGAGGG - Intergenic
1089297225 11:117477051-117477073 CTGTCTCCATTTTATACATAAGG + Intronic
1089589929 11:119533600-119533622 CTGCCTCCCCTCCAGACAGAAGG - Intergenic
1089845903 11:121458063-121458085 CTGTGTCCCTCCATTACAGTGGG - Intronic
1090659935 11:128874771-128874793 CTGTTTCCCATCCATACATAAGG + Intergenic
1090806701 11:130207173-130207195 CTGGTTCCTTTCAATAGAGAAGG + Intronic
1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG + Intronic
1092895992 12:13010789-13010811 CTGTCTCCCATCAGAACATAGGG + Intergenic
1096174010 12:49499642-49499664 CTTTGTCCCTTCAATTCAGGGGG + Intronic
1097768474 12:63552715-63552737 CAGTCTCCCATGAATATAGAGGG + Intergenic
1099970610 12:89496142-89496164 CTGTCTCCCTTCAACCCAGATGG - Intronic
1101394770 12:104336962-104336984 CTGTCTTCCTTCACTTCAAAAGG + Intronic
1101546288 12:105716555-105716577 CTGTCTCACTTCTCTACAGCTGG - Intergenic
1103838872 12:123846533-123846555 GTGTCTCCCTCCAGGACAGAGGG + Intronic
1104379244 12:128292321-128292343 CTGTCTCCCTTGTACACAGCAGG - Intronic
1104629714 12:130390387-130390409 GTGTCTCCCTTCAGAGCAGAGGG + Intergenic
1104988359 12:132610347-132610369 CTGTCTCACCTCTACACAGAGGG - Exonic
1108404197 13:50083224-50083246 CTGTCTACCTTCAAAAAAAATGG + Intronic
1110375201 13:74785609-74785631 CTGTTTCCCTGCAATAAAAAGGG - Intergenic
1110668620 13:78148622-78148644 CTGTCTCCCACAAATACAGTGGG + Intergenic
1110743558 13:79026253-79026275 CTGTCTCCCATCACCCCAGATGG - Intergenic
1114890442 14:26915052-26915074 CTGTCTCCCATCATCCCAGATGG - Intergenic
1116347679 14:43815682-43815704 GTGTCTCCCTCCAATAAAGCTGG - Intergenic
1118942573 14:70351261-70351283 CACTCTCCCTTTAATACAAACGG + Intronic
1120292050 14:82587783-82587805 CTGTCTAGTGTCAATACAGAAGG - Intergenic
1120576829 14:86192365-86192387 ATATTTCTCTTCAATACAGATGG - Intergenic
1124447784 15:29753617-29753639 CTTTCAACCTTCACTACAGAAGG + Intronic
1125301982 15:38264715-38264737 CTGTCTCTCTTGATTGCAGAGGG - Intronic
1126248074 15:46533907-46533929 CTTTCTCCCTTCAAGAAATAAGG - Intergenic
1127881394 15:63161579-63161601 CTGGCTCCCTTCACCTCAGAAGG + Intergenic
1133922088 16:10162524-10162546 CTGTCTCCTTGGCATACAGATGG + Intronic
1134393858 16:13844294-13844316 CTGTCTCCCATCACCCCAGATGG - Intergenic
1135991719 16:27222597-27222619 CTGTCACGCTACACTACAGATGG - Intergenic
1144352314 17:14408891-14408913 CTCTCTCCCTTCAACATACATGG - Intergenic
1146585101 17:34075581-34075603 CTGACTCCCTGCAGTACATATGG + Intronic
1149202521 17:54203467-54203489 ATGTCACACTTCCATACAGAGGG - Intergenic
1151061560 17:71100608-71100630 GTGTCTCCCTTCATTTCATATGG + Intergenic
1152335148 17:79696518-79696540 CTATCTCCCTCTGATACAGAAGG + Intergenic
1153900156 18:9611484-9611506 CTTTCTCCCTTCACAAGAGATGG + Intronic
1155839607 18:30629694-30629716 CTGTCTCCTTCCAATGGAGATGG - Intergenic
1158795486 18:60840606-60840628 CTGTCTCCATTACATCCAGATGG - Intergenic
1159951525 18:74487653-74487675 CTGTCTCCCACCCATACAGTAGG + Intergenic
1164477767 19:28588360-28588382 CTTTTTCCCTTCAAAACAGAAGG - Intergenic
1165304501 19:34995232-34995254 CTGTGTCCCTTCCACACAAAGGG - Intronic
1165554831 19:36621404-36621426 CTGTCACCCTTGAAAACAGAGGG - Intronic
927295503 2:21448352-21448374 TTGTCTCCTTGCAATAGAGAAGG + Intergenic
927716076 2:25354064-25354086 CTGTTACCCAGCAATACAGAGGG - Intergenic
928859489 2:35839630-35839652 TTTTCTCCCTTCAACAAAGAAGG + Intergenic
928935383 2:36670977-36670999 CTGCTTACCTTCACTACAGAAGG - Intergenic
929377697 2:41309571-41309593 TTGTCTCCCTCCAATATATAAGG - Intergenic
931377276 2:61718703-61718725 CTGTCTCCCATCACCCCAGATGG + Intergenic
932993703 2:76821329-76821351 CTGGCTCCCTTCAATCCAGTTGG + Intronic
933812036 2:86038807-86038829 CTGTTTTTCTTCCATACAGAAGG + Exonic
937387686 2:121451396-121451418 CTGTCTACATCAAATACAGAGGG + Intronic
940050084 2:149452908-149452930 CTGTCTCTCTTCTTTTCAGAAGG + Intronic
940268636 2:151867262-151867284 CTGGCTGCCTTCAATCCACAGGG + Intronic
940986797 2:160059006-160059028 CTGTCTCCCGTCACCCCAGATGG - Intronic
942192197 2:173481377-173481399 CTGTCTCCTCTCAACACAGCAGG - Intergenic
942501184 2:176592452-176592474 CTGTCTCCTTTCTATCCACAGGG - Intergenic
943146165 2:184048120-184048142 CTTTTTGTCTTCAATACAGAAGG + Intergenic
943664319 2:190592758-190592780 CTGTATCCACCCAATACAGATGG + Intergenic
943734189 2:191336007-191336029 CTCACTCCCATGAATACAGATGG + Intronic
944403013 2:199350274-199350296 CTGTCTCCCTATTATACAAATGG + Intronic
946047503 2:216833432-216833454 CTGTTTCCCTACATCACAGAGGG - Intergenic
946047845 2:216836219-216836241 CTCTCTCCCTTCACTAAACATGG - Intergenic
1169540138 20:6591051-6591073 CTGTCTCCCATTAATACAGTGGG - Intergenic
1171377185 20:24701420-24701442 CTGTGTTTCTCCAATACAGAAGG + Intergenic
1172201710 20:33131633-33131655 CTGTCCTGCTTCAATAAAGATGG + Intergenic
1177678857 21:24337949-24337971 CTGTGTCCCTTCATTAAAGAAGG + Intergenic
1181537556 22:23554387-23554409 CTGGCTCCGTTCACTCCAGATGG + Intergenic
1184565766 22:45290915-45290937 CTGTCTCCCATCACCCCAGATGG + Intronic
949612540 3:5717219-5717241 TGGACTCCCCTCAATACAGATGG - Intergenic
950123124 3:10495052-10495074 CTGCCTCCCTACAAGACAGCAGG - Intronic
950454243 3:13083244-13083266 CTGTCTCCCATTAATGCAGATGG + Intergenic
951315102 3:21180026-21180048 CAGACTCCCTTCACCACAGAGGG + Intergenic
951419090 3:22462638-22462660 CTGTTTCCTTTCACTACTGAGGG - Intergenic
953811486 3:46116507-46116529 TTTTCTCCCTTCAATAGAAATGG + Intergenic
956404680 3:68915895-68915917 CTATCTCCATTCAATAAATATGG + Intronic
956741938 3:72281993-72282015 TTGTCTCCCTTCAAGACTGTGGG + Intergenic
959213874 3:103424616-103424638 ATGTCTACCTCCAATGCAGAGGG - Intergenic
961051507 3:123750961-123750983 CTGTCTCCCCACACCACAGAAGG - Intronic
964117164 3:153148369-153148391 TTGTCTCCCTCCACTATAGAAGG + Intergenic
968369134 3:198211104-198211126 CTGTCTCCCATCACCCCAGATGG + Intergenic
969100577 4:4765250-4765272 CTGTCTTACTTCAATAAAAATGG - Intergenic
969648507 4:8448402-8448424 CTGTGTCCCCTCAATAGAAACGG + Intronic
969723301 4:8905161-8905183 CTGTTTCCCTACAACACAGCTGG - Intergenic
970686544 4:18573939-18573961 CTGGCTTCCTACAATACAGCTGG + Intergenic
971252851 4:24987655-24987677 CTGTCTCCCTGGCTTACAGATGG - Intergenic
971453230 4:26819383-26819405 CTGTTTCCCCTCAACAGAGAGGG + Intergenic
971684756 4:29749511-29749533 CTGTCTCCATTCAGTGCACAGGG - Intergenic
972342708 4:38166239-38166261 ATGTCTCCCTGAAATGCAGATGG + Intergenic
972380070 4:38511276-38511298 ATGTCTTCCTTCCACACAGAAGG - Intergenic
972695052 4:41437185-41437207 CTGTATCCCTTCCTTACAAAAGG - Intronic
972713970 4:41627193-41627215 CAATCTCCCTTAAATGCAGATGG + Intronic
974210502 4:58767437-58767459 CTGTCTCTTTGCAATTCAGATGG + Intergenic
976411540 4:84718864-84718886 CTGTCTCCCTTCATGAGAGCAGG - Intronic
978308751 4:107362239-107362261 CTGTCTCCCTTTTATAGACACGG - Intergenic
979257560 4:118620813-118620835 CTGTCTCCCATCACCCCAGATGG + Intergenic
979330789 4:119419734-119419756 CTGTCTCCCATCACCCCAGATGG - Intergenic
979907213 4:126309924-126309946 CTGTATCCCTTCAACTCAGCAGG - Intergenic
981482581 4:145254035-145254057 CTGTCTCCACTCAAGGCAGATGG - Intergenic
983556417 4:169063059-169063081 CTTTCTCCCTGCGATTCAGAGGG - Intergenic
983635197 4:169891083-169891105 CTCTCTCACTTCCTTACAGAGGG + Intergenic
983954252 4:173678234-173678256 CTGTCTCCCTGGCATACAGATGG - Intergenic
986929791 5:12804416-12804438 CTTTCTCCCTTCACAACATAAGG + Intergenic
987428793 5:17805563-17805585 CAGTCTGCCTTCAAGAAAGAAGG - Intergenic
987742614 5:21929367-21929389 CTGTCTCCCATCACCCCAGAAGG - Intronic
991438314 5:66618598-66618620 CTGTCTCCCTTCAATACAGAGGG - Intronic
992066299 5:73113243-73113265 CTGTTTCCAATCAAGACAGAAGG + Intergenic
992912830 5:81415285-81415307 CGGTCTCCCTTGGATACGGAGGG - Exonic
994503765 5:100613674-100613696 CTGTCTCCCATCACCCCAGATGG + Intergenic
994686676 5:102963279-102963301 CTGTCTCCTTACAACACATAGGG + Intronic
994796323 5:104305380-104305402 TTGAAACCCTTCAATACAGAGGG + Intergenic
996814931 5:127564221-127564243 CTGTCTCACTGTAATTCAGAAGG - Intergenic
997321128 5:132979627-132979649 CTGTTTCCATTCATGACAGAAGG + Intergenic
999112779 5:149136646-149136668 CTGTTTCCCTTGAATAAAGCTGG - Intergenic
999802389 5:155050030-155050052 CTGTCTCCCTCCAATAAAACTGG - Intergenic
1003176630 6:3757097-3757119 CTGTTTCTCTTCAAAACAAAAGG + Intergenic
1003431534 6:6043241-6043263 CTGTCTCCTTACACTTCAGAGGG - Intergenic
1004000576 6:11593463-11593485 CTGTTTGCCTGCAATAGAGAGGG + Intergenic
1004599285 6:17132246-17132268 CTGTCTCCCATCACCTCAGATGG + Intergenic
1005872088 6:29982093-29982115 CTGTCTCCATTCAATAGTGCAGG + Intergenic
1009883509 6:69598454-69598476 CTTTCTCTCCTCAATACAAAAGG + Intergenic
1012060275 6:94469568-94469590 CTGTTGCCCTTCAATCCTGATGG + Intergenic
1012310631 6:97720034-97720056 CAGACTCCCTACAATACAAATGG + Intergenic
1012433913 6:99194403-99194425 CTGTCTCCCATCACCCCAGATGG + Intergenic
1012509082 6:99982089-99982111 CTGTCTCTGTTCTATTCAGATGG + Intronic
1013459260 6:110359047-110359069 CTGTCTCGCAGAAATACAGAGGG + Intergenic
1016004304 6:139074165-139074187 CTGTCTCCCATCACCCCAGATGG - Intergenic
1018223678 6:161607040-161607062 CTGCCTCCCTTCCAGACTGACGG + Intronic
1018450925 6:163906727-163906749 CTGTCTGCCTTCAGCACTGATGG + Intergenic
1018596555 6:165487346-165487368 CTGTCTCCCGTCACCCCAGACGG + Intronic
1024072481 7:45797877-45797899 CTGTCTCCCATCACCCCAGATGG + Intergenic
1024650852 7:51402303-51402325 CTGTCTCCCATCACCCCAGATGG - Intergenic
1025133042 7:56388105-56388127 CTGTCTCCCATCACCGCAGATGG - Intergenic
1025184685 7:56848529-56848551 CTGTCTCCCATCACCCCAGATGG - Intergenic
1025687245 7:63728433-63728455 CTGTCTCCCATCACCCCAGATGG + Intergenic
1025912164 7:65838014-65838036 CTTTCTTCCATCAATTCAGATGG + Intergenic
1026177505 7:68010671-68010693 CTGCTTCCCCTCAAGACAGAAGG - Intergenic
1026832496 7:73618694-73618716 ATGTCTCCCTACCAAACAGATGG - Intronic
1027225728 7:76242686-76242708 CTGTCTCCCATCACCCCAGATGG - Intronic
1027815253 7:82960052-82960074 CTGTTTGCCTTCAATATGGAAGG - Intronic
1029090802 7:98046602-98046624 CTGTCTCCCTGGCTTACAGATGG - Intergenic
1030321690 7:108175354-108175376 CTGTTTCCCTTCATTAAAGCTGG - Exonic
1030356634 7:108550648-108550670 CTCTCTCCCTGTATTACAGATGG + Intronic
1032171035 7:129584774-129584796 CTGTCTGCCTTCAAAAAGGAAGG + Intergenic
1034721968 7:153301656-153301678 CTGTCTCCCTTCAGTTTACAAGG - Intergenic
1038127421 8:24690333-24690355 CTGTGTCCCTTCAATATACCAGG + Intergenic
1040706017 8:50128213-50128235 CTATCTCCCTCCATTACTGATGG + Intronic
1044599738 8:93991751-93991773 CTTTCTACCTTCAATCCAGCAGG + Intergenic
1044845888 8:96380811-96380833 CTGTCTGCCTTCAAGGCAGTGGG - Intergenic
1044870142 8:96611574-96611596 CTGTGTCCCTCAATTACAGAGGG + Exonic
1045007290 8:97927728-97927750 TTCTCTCCCTTCAAAACAAATGG - Intronic
1047632151 8:126719903-126719925 CTGGCTCCCGTCAGTACATATGG - Intergenic
1049943093 9:567580-567602 CTGGCTCCAATCAATGCAGAAGG - Intronic
1051994717 9:23201159-23201181 CTGTCTCCATCCAGTAAAGAGGG - Intergenic
1052308973 9:27043432-27043454 CTGTCTGCTTTCTCTACAGAAGG + Intronic
1053237399 9:36468385-36468407 CTCTGGCCCTTCAATCCAGAGGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056227625 9:84511467-84511489 CTGTCTCACTTCCACACAGCAGG - Intergenic
1056724943 9:89106531-89106553 CTGCCTCCCCTCACTACTGAAGG - Intronic
1062753475 9:138273788-138273810 CTGTCTCCCATCACCCCAGATGG + Intergenic
1203567991 Un_KI270744v1:108109-108131 CTCTCTCCCTTCCATTCACAGGG - Intergenic
1203569051 Un_KI270744v1:115096-115118 CTCTCTCCCTTCCATTCACAGGG - Intergenic
1186111191 X:6257469-6257491 CTGTCTCTTTTAACTACAGAAGG - Intergenic
1186786549 X:12961604-12961626 CTCTCTGCCTTCAGTAGAGAAGG + Intergenic
1190218869 X:48498035-48498057 CTGTCTCCATTCAGAGCAGATGG + Intergenic
1191182588 X:57579108-57579130 CTGTCTCCCTTCTTTTCAAAAGG + Intergenic
1192321844 X:70096158-70096180 CTGTCTTCCTTCAAGGCAGCTGG + Intergenic
1195067665 X:101252328-101252350 CTGTCTCCCTTAAACAAAGGTGG + Intronic
1195214460 X:102685049-102685071 CTGTTTCCCTTCTATATACAGGG + Intergenic
1197099537 X:122636488-122636510 CTCTCTCCCTTCAAGGCAGTGGG + Intergenic
1199449222 X:147960970-147960992 CTGTGTCCTGTGAATACAGAAGG + Intergenic
1199568746 X:149246332-149246354 CTGTCCCCCTTCAGGACAGTGGG + Intergenic
1202182745 Y:22153492-22153514 CTGTCTCCCTTTTTGACAGAGGG + Intergenic
1202208614 Y:22432909-22432931 CTGTCTCCCTTTTTGACAGAGGG - Intergenic