ID: 991442253

View in Genome Browser
Species Human (GRCh38)
Location 5:66663202-66663224
Sequence ATGTATACACACATGCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991442253_991442255 16 Left 991442253 5:66663202-66663224 CCTCAGTGCATGTGTGTATACAT 0: 1
1: 0
2: 8
3: 44
4: 342
Right 991442255 5:66663241-66663263 TTAATCACCAACTCCTTTTTAGG 0: 1
1: 0
2: 1
3: 14
4: 201
991442253_991442256 21 Left 991442253 5:66663202-66663224 CCTCAGTGCATGTGTGTATACAT 0: 1
1: 0
2: 8
3: 44
4: 342
Right 991442256 5:66663246-66663268 CACCAACTCCTTTTTAGGAATGG 0: 1
1: 0
2: 1
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991442253 Original CRISPR ATGTATACACACATGCACTG AGG (reversed) Intronic
900739224 1:4320539-4320561 ATGCACACACACAGGCACCGGGG - Intergenic
901888098 1:12238283-12238305 ATGTATACATACAGGCATGGTGG + Intronic
902520428 1:17012608-17012630 CTGCAGACACACCTGCACTGGGG + Intergenic
903199048 1:21718170-21718192 ATGTACACACAGATGCAGTGAGG - Intronic
903333630 1:22610542-22610564 ATGAACGCACACATGCACGGTGG - Intergenic
903590936 1:24455466-24455488 ATGTTTGCACATATGCACAGGGG + Intronic
904605061 1:31693470-31693492 ATGGACACACACATGCACGGTGG + Intronic
904914853 1:33962401-33962423 GTGCAAACACACATGCTCTGTGG + Intronic
906246787 1:44281791-44281813 ATGGATACAGACATGCAATTTGG + Intronic
907961680 1:59289491-59289513 ATGTAGACACACATACACATAGG - Intergenic
908905096 1:68999237-68999259 ATATATAGACACATACACTGTGG - Intergenic
908925295 1:69247325-69247347 ATGTATACATACATGCCTTTAGG + Intergenic
909638408 1:77844190-77844212 ACACATACACACATTCACTGTGG + Intronic
909916373 1:81324590-81324612 ATATATACACACACACACTTTGG + Intronic
910048541 1:82948143-82948165 AGGTAAACACACTTGCCCTGTGG + Intergenic
910213009 1:84813189-84813211 ATATACACACACATGCATGGAGG + Exonic
910574979 1:88751279-88751301 ATATATACACACATACACTCTGG + Intronic
911522318 1:98943573-98943595 ATTTATGCACTCATGGACTGAGG - Intronic
913021706 1:114794605-114794627 ATGTATACATACATGCACAAAGG + Intergenic
913061001 1:115207760-115207782 ATGTATGCACAAATACACTGTGG + Intergenic
916385734 1:164266029-164266051 AATTATACACACACGCACAGAGG + Intergenic
917598697 1:176554460-176554482 GTGTACACGCACATGCACTTAGG + Intronic
917627563 1:176861702-176861724 ATACATACACACATTCAGTGGGG + Exonic
918670515 1:187209630-187209652 ATGTATACACACACACACACAGG - Intergenic
919101641 1:193104253-193104275 ATGAATAGAAACATGCACGGAGG + Intronic
920280782 1:204842005-204842027 ATGTATAAGCACCTGGACTGGGG - Intronic
920584883 1:207148448-207148470 ATGGATACATCCATTCACTGTGG - Intergenic
920774889 1:208926370-208926392 AGGTATACACACACACACGGTGG + Intergenic
921562674 1:216677192-216677214 ATGTATTCACACTTGGTCTGGGG + Exonic
921582945 1:216916029-216916051 ATGTACACACACACACACAGTGG - Intronic
1063135924 10:3216145-3216167 ATGTATACACACATGCACACAGG + Intergenic
1065369349 10:24967637-24967659 ATGTACACACACACGCACATAGG - Intergenic
1065852662 10:29803785-29803807 ATGTAAATACACAAGCTCTGAGG - Intergenic
1066076789 10:31887029-31887051 ATGTATACACACACATCCTGTGG - Intronic
1066169898 10:32830168-32830190 ATGTATATACACATGTATTAGGG - Intronic
1068407595 10:56611031-56611053 GTATATACACACATACCCTGAGG + Intergenic
1068702786 10:60037651-60037673 ATGTACACACACATACACCATGG - Intronic
1068800794 10:61137722-61137744 TAAGATACACACATGCACTGAGG - Intergenic
1069401225 10:68049070-68049092 ATATATATACACATACACAGAGG - Intronic
1070719416 10:78745957-78745979 ATGAAAACACACCTGTACTGGGG - Intergenic
1070882622 10:79862715-79862737 ATATATAGACACATGAACAGAGG - Intergenic
1071640088 10:87298551-87298573 AAGTATAAACTCAGGCACTGGGG + Intergenic
1071649189 10:87379017-87379039 ATATATAGACACATGAACAGAGG - Intergenic
1071655146 10:87439394-87439416 AAGTATAAACTCAGGCACTGGGG - Intergenic
1072864630 10:99044827-99044849 ATATATACACACTTACATTGGGG + Intronic
1073877222 10:107938908-107938930 ATATATACACACACACACTATGG + Intergenic
1074422104 10:113318089-113318111 ACGTATGCACACATGCACACAGG - Intergenic
1074968517 10:118515827-118515849 ATGTACACACACATGTCCTTTGG - Intergenic
1075569370 10:123528700-123528722 ATATATACACACACATACTGTGG + Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076211615 10:128651007-128651029 ATATATACACACATACACCATGG - Intergenic
1077821537 11:5747503-5747525 ATATATATACACATACATTGTGG - Intronic
1079535769 11:21513365-21513387 ACACATACACACATTCACTGAGG - Intronic
1079799131 11:24846820-24846842 ATGTATACACACACACATAGAGG - Intronic
1079853238 11:25565610-25565632 AAGTATAAATACATGCACTCTGG - Intergenic
1080018174 11:27529613-27529635 AAATATACTTACATGCACTGTGG - Intergenic
1080188234 11:29518084-29518106 ATGTATACACACATCTACTGTGG - Intergenic
1082094114 11:48113233-48113255 ATGTATATACATATGCACACAGG - Intronic
1083161324 11:60855992-60856014 CCCTAAACACACATGCACTGGGG - Intergenic
1084554392 11:69867286-69867308 ATAGACACACACATGCCCTGTGG - Intergenic
1086251800 11:84824820-84824842 ATGTTGCCACACATGCACTGTGG - Intronic
1086480557 11:87232656-87232678 ATCTGTACATACATGCACTATGG + Intronic
1086762898 11:90655620-90655642 ATGTATACACACATAGACATAGG + Intergenic
1086896180 11:92315432-92315454 ATATATACACACACACACTGAGG - Intergenic
1087013678 11:93536576-93536598 CTGTATACACAAATACACTATGG - Intronic
1087069216 11:94060140-94060162 ATATATATATACACGCACTGGGG + Intronic
1087333309 11:96811617-96811639 ATATATACACACATACACAATGG - Intergenic
1087517930 11:99189200-99189222 ATGTATACACACACACACTATGG - Intronic
1088396583 11:109376458-109376480 ATGAAAACACAAATGCCCTGAGG + Intergenic
1089881555 11:121778431-121778453 ACGTACACACACATGCTGTGGGG - Intergenic
1090242410 11:125193475-125193497 TTGTATGCACACATGCACACTGG - Intronic
1090399201 11:126438014-126438036 ATGTACACACACATACTCTGGGG + Intronic
1091735727 12:2920122-2920144 ATACAAACACACATGCACGGAGG - Intronic
1092509264 12:9136508-9136530 ATGCACACACACATGCACAATGG - Intergenic
1093072465 12:14721266-14721288 ATGTATACACACATACACAATGG - Intergenic
1093116467 12:15217951-15217973 GTGTACAAACACATGCAGTGGGG + Intronic
1093350647 12:18097082-18097104 ATGTATACATACATGTACACAGG - Intronic
1093491168 12:19706439-19706461 ATATATACACATATGCACAATGG + Intronic
1094079327 12:26515758-26515780 ATGGATACAAATATGAACTGCGG - Intronic
1094550799 12:31449310-31449332 ATGTATATACACCTGAACTATGG - Intronic
1094785343 12:33842049-33842071 ATGTACACACACACACACAGAGG - Intergenic
1095420115 12:42016693-42016715 ATATTTGCACACATTCACTGGGG - Intergenic
1095722783 12:45418740-45418762 ATGTGTACAGACATTCACTCTGG + Intronic
1096323408 12:50636233-50636255 ATGCATACATACATACACAGAGG - Intronic
1098259127 12:68649752-68649774 ATGTATACACACATACATGCAGG - Intronic
1099139463 12:78953452-78953474 GTGTATACATAAATGCACTTCGG - Intronic
1099771952 12:87071568-87071590 ATATATACACACACACACAGTGG + Intergenic
1100371503 12:93973003-93973025 ATGTAGAAACACATACTCTGTGG - Intergenic
1100680811 12:96918426-96918448 ATATCTACACACATACACAGAGG + Intronic
1102404027 12:112656780-112656802 ATATATACACACACACACCGTGG - Intronic
1102472729 12:113168624-113168646 ATGTATACAGAAATGTCCTGTGG + Intronic
1102889653 12:116548607-116548629 ATGTCTACACACCTGCCCTTAGG + Intergenic
1103036009 12:117656907-117656929 ATGTATACACACACACACAAAGG - Intronic
1104811281 12:131621734-131621756 GTGTACACACACATGCACATGGG + Intergenic
1106219751 13:27735689-27735711 ATTTGGACACACATGCACAGAGG + Intergenic
1108051413 13:46444428-46444450 GTGTATACACACATGCACAGGGG + Intergenic
1109393325 13:61721736-61721758 ATATATACACACATACACATAGG - Intergenic
1109399730 13:61810039-61810061 ATGAATTCACACATGCAATAGGG + Intergenic
1109543969 13:63818051-63818073 GTGTATACACACATGCACAGGGG + Intergenic
1109626999 13:64987637-64987659 GTGTATACACACATACACTCAGG - Intergenic
1109627000 13:64987666-64987688 ATATATACACACATACACTCAGG + Intergenic
1109765610 13:66892170-66892192 ATATATACACACACACAATGAGG - Intronic
1109966126 13:69698816-69698838 ATATATACACACATACACAATGG + Intergenic
1110254765 13:73420595-73420617 ATATATACACACACACACTGTGG - Intergenic
1110397788 13:75051942-75051964 ATGCATACACACACACACAGTGG + Intergenic
1111133670 13:84010107-84010129 GTGTATACACACATGCAGAGAGG - Intergenic
1112458062 13:99579637-99579659 ATGTATACACACATACAAACAGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1114840389 14:26256238-26256260 CTGTATACACAAATGCCTTGAGG - Intergenic
1115401037 14:32960894-32960916 ATGTTTAAACACATGTGCTGAGG - Intronic
1117109601 14:52436800-52436822 ATGTATATACACATACACTCTGG - Intronic
1117177612 14:53161091-53161113 ATGTATATACACACACAGTGTGG - Intergenic
1117265723 14:54084598-54084620 TTGTATAAATACTTGCACTGTGG - Intergenic
1117847520 14:59927157-59927179 ATGTATACACACATGCCTATGGG + Intronic
1118158651 14:63266910-63266932 ATGTCTGCACACACACACTGTGG - Intronic
1118616676 14:67578835-67578857 ATGTATCCACGGATGTACTGTGG + Intronic
1119843687 14:77812490-77812512 ATATATACACACACACACTATGG - Intronic
1120538252 14:85723261-85723283 ATGTATACACACATATGATGTGG + Intergenic
1121056057 14:90854017-90854039 GTGTATACACACATGTATTGGGG - Exonic
1122103226 14:99430233-99430255 ATGCACACACACATGCACAATGG + Intronic
1122364202 14:101184801-101184823 ATGTACACACACATACACACAGG - Intergenic
1123200808 14:106662061-106662083 ATGCACACACACATACACAGTGG + Intergenic
1125356044 15:38818336-38818358 ATATATACACACAGGCACACAGG + Intergenic
1126999814 15:54489474-54489496 ATATATACACACATACATTGAGG - Intronic
1127341754 15:58052864-58052886 AGGTATACACACATCCACTTTGG - Intronic
1127822798 15:62674941-62674963 ATCCATGCACACATGCAGTGTGG - Intronic
1130130700 15:81139681-81139703 ATTTATACACAAATGCACACTGG - Intronic
1131647198 15:94358190-94358212 ATATACACACACATACACAGTGG - Intronic
1131868970 15:96742168-96742190 AAGCATGCACACATGCTCTGGGG + Intergenic
1134128761 16:11634132-11634154 ACTTATACACACATGCACACAGG + Intronic
1134882363 16:17756673-17756695 CTGTATACAAACATGCAATCTGG - Intergenic
1137534615 16:49309611-49309633 ATATTTGCACAGATGCACTGGGG - Intergenic
1137627283 16:49917254-49917276 AAATATCCACACATGTACTGAGG + Intergenic
1138138871 16:54549251-54549273 ATTTATACACACATACAAAGAGG - Intergenic
1138885726 16:61075744-61075766 ACATATACACACATACACAGAGG + Intergenic
1140247560 16:73265007-73265029 ATATATATATATATGCACTGAGG - Intergenic
1141136781 16:81470954-81470976 ATGCATACACACATGCACACAGG + Intronic
1141136782 16:81470984-81471006 GTGCATACACACATGCACACAGG + Intronic
1141136783 16:81471028-81471050 GTGCATACACACATGCACACAGG + Intronic
1142244928 16:88966015-88966037 CTGTATGCACCCATGCTCTGTGG - Intronic
1143297214 17:5880378-5880400 AGGTAAACAGACATGTACTGTGG + Intronic
1144246299 17:13369189-13369211 ATATATACACACACGCACCATGG - Intergenic
1144720378 17:17465196-17465218 AAGTAAACACACATGTAATGAGG + Intergenic
1145789063 17:27613546-27613568 CTGGAGACCCACATGCACTGGGG - Intronic
1147760384 17:42794381-42794403 ATGTATGCACACATACAGAGGGG - Intronic
1148918808 17:51010611-51010633 ATGTATACACACACACATTTAGG + Intronic
1148984012 17:51605562-51605584 ATACACACACACATACACTGTGG + Intergenic
1149462849 17:56847061-56847083 ATGTATAAAAATATTCACTGTGG - Intronic
1149679373 17:58494524-58494546 ATGCATACACGCTTACACTGGGG - Intronic
1150054450 17:62000596-62000618 ATGTATGCACATATGTACTTTGG + Intronic
1150457590 17:65319973-65319995 TTAAATATACACATGCACTGAGG - Intergenic
1151881901 17:76900964-76900986 ATGCACACACACATGCACACAGG - Intronic
1151907047 17:77055476-77055498 AGGTACACACACATGCACACAGG - Intergenic
1152285824 17:79412806-79412828 ATATACACACACATGCATAGAGG - Intronic
1152295737 17:79466062-79466084 GTGTCTCCACACATGCACTTTGG - Intronic
1153633782 18:7096678-7096700 ATATATACACATATGGAATGGGG - Intronic
1153725653 18:7952068-7952090 ATGCATATATACATGCATTGTGG - Intronic
1154972278 18:21422335-21422357 ATGTATATACACACGCACATAGG - Intronic
1155752682 18:29447356-29447378 ATGTATACACACATACACTCAGG - Intergenic
1156590478 18:38482394-38482416 ATGGACACACACATGCACACTGG - Intergenic
1156744823 18:40377104-40377126 ATGTATAGATACATTCATTGGGG - Intergenic
1156915342 18:42459902-42459924 AGGTATATACATATGCACTTAGG + Intergenic
1157226275 18:45867922-45867944 AAATATACACACATACACTGTGG - Intronic
1158008179 18:52697272-52697294 ACATACACACACATGCAATGTGG + Intronic
1158716617 18:59886049-59886071 ATGTTTCCACCCAAGCACTGTGG + Intergenic
1158798574 18:60878270-60878292 ATATATACACACATACAATTTGG + Intergenic
1161213126 19:3078332-3078354 ACATATACACACATGTACTCAGG + Intergenic
1161326478 19:3666555-3666577 AGGCAAACACACATGCACTCAGG + Intronic
1163311831 19:16519521-16519543 ATCCATCCCCACATGCACTGAGG + Intronic
926765015 2:16316627-16316649 ATGTATCTAAACATGCCCTGTGG - Intergenic
926783047 2:16493121-16493143 ACGTACACACACATGCACACAGG + Intergenic
927281708 2:21314202-21314224 ATGTATTCAAACATGCTCTTTGG - Intergenic
927370675 2:22351711-22351733 ATATATACACACACACACTATGG + Intergenic
927677700 2:25118434-25118456 GTGTATACACACACACACAGTGG - Intronic
928051137 2:27996482-27996504 ATTTAAACACACAAGCAGTGTGG + Intronic
928297775 2:30099781-30099803 ATATATACACACATACACCATGG - Intergenic
928486181 2:31734781-31734803 ATGTACACACACATTACCTGGGG - Intergenic
928808575 2:35193599-35193621 ATATATACACACATACACCATGG + Intergenic
929076122 2:38080316-38080338 ACACATACCCACATGCACTGAGG + Intronic
929324677 2:40594841-40594863 ATGTGTACACACATGCACAAAGG - Intronic
929791623 2:45027501-45027523 AAGTGTACACACATGCAGTCAGG + Intergenic
930209873 2:48624907-48624929 CTGTATACACACACACACAGAGG - Intronic
930245080 2:48975441-48975463 AAGGAGACAGACATGCACTGGGG - Intronic
930534126 2:52626544-52626566 GTGTACACACACATACACAGAGG + Intergenic
930672335 2:54164234-54164256 ATGGATGCACACAGGAACTGGGG + Intronic
935932955 2:108149361-108149383 ATTTATACACATATGCTCAGTGG - Intergenic
936580400 2:113695356-113695378 TTTGATACACATATGCACTGGGG - Intergenic
940199362 2:151133026-151133048 GTGTATACACACATGCAAGGTGG - Intergenic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
941653152 2:168115294-168115316 ATGTATACACCCATGCACATGGG - Intronic
941938756 2:171010430-171010452 ATGTATACAAACATACTTTGAGG + Intronic
942966537 2:181900524-181900546 ATGTTTACACATGTGTACTGGGG - Intronic
943387072 2:187214820-187214842 ATGTATACACAAATGCTAAGAGG + Intergenic
943476561 2:188364936-188364958 ATATATACACACACACACTTGGG + Intronic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943984235 2:194599208-194599230 ATATATAAATATATGCACTGTGG - Intergenic
944627045 2:201581454-201581476 ATGTATACACACACACATTCCGG + Intronic
945598467 2:211826938-211826960 ATATATACACACATGCAAAAGGG - Intronic
946491933 2:220157037-220157059 ATGTACACAGACATACACAGAGG - Intergenic
946565818 2:220964335-220964357 ATGTAAACACACACACATTGAGG - Intergenic
946874969 2:224119813-224119835 ATATATACACACACACACTATGG + Intergenic
948325162 2:237112259-237112281 ATGTATCGACACTTGCTCTGTGG - Intergenic
948674808 2:239591046-239591068 AGGTAAACATACATGCACTCAGG + Intergenic
1168976705 20:1971675-1971697 ATGTATATACACTTACAGTGGGG + Intergenic
1169251697 20:4066128-4066150 ATGTGCACACACATCAACTGAGG + Intergenic
1169637229 20:7705996-7706018 ATGAATTAAAACATGCACTGAGG + Intergenic
1169840562 20:9931254-9931276 ATATATACCCACATGCAATTTGG + Intergenic
1170114252 20:12839461-12839483 ATGTATACCCCAGTGCACTGAGG - Intergenic
1172999445 20:39094973-39094995 ATGGACACAGACATGCACAGAGG - Intergenic
1174565824 20:51463843-51463865 ATGTACCCACAGATGCACTGAGG - Intronic
1175527682 20:59646802-59646824 ATGCATGCACACATGTTCTGTGG + Intronic
1175793857 20:61758924-61758946 ATGTGTACACCCATGCACACAGG - Intronic
1176132549 20:63502444-63502466 ATGAATCCACACCTGCTCTGGGG - Intergenic
1176176925 20:63732673-63732695 ATGCATACACACATGCACACAGG - Intronic
1177301414 21:19250013-19250035 ATGTAAACAAACAACCACTGTGG - Intergenic
1177680638 21:24364608-24364630 ACATATACACACATGCATGGAGG + Intergenic
1177999862 21:28149023-28149045 ATGCATACACACATGCACACTGG + Intergenic
1178762993 21:35421912-35421934 AGGTACACACACATGCACACAGG + Intronic
1179268399 21:39826413-39826435 ATATATACACACACACACTATGG - Intergenic
1183719151 22:39552283-39552305 ATGCGCACACACATGCACTCTGG + Intergenic
1184815408 22:46865108-46865130 ATTTATACACACAGGTGCTGAGG - Intronic
1184894449 22:47399119-47399141 ATGTAAACACACATGCCCCAGGG + Intergenic
1185094995 22:48801295-48801317 ATACATACACACATGCACACAGG + Intronic
949243040 3:1893789-1893811 ATACATACACACATACACTTGGG - Intergenic
949478188 3:4468431-4468453 AGGTACACACACACTCACTGAGG + Intergenic
949823229 3:8137898-8137920 GTGTATAAACACACCCACTGTGG - Intergenic
951382926 3:22007488-22007510 ATTTATAGCCACATGCCCTGAGG - Intronic
954496888 3:50972698-50972720 ATGTGGAAACACAAGCACTGAGG + Intronic
954547298 3:51447968-51447990 ATGTTTACAGACAGACACTGAGG + Intronic
954872641 3:53779449-53779471 ATGTATATACACACACACAGAGG + Intronic
955140784 3:56267247-56267269 CTGTATACACACACACACAGTGG + Intronic
955694384 3:61621018-61621040 ATATATACACACACACACTGGGG - Intronic
959239147 3:103766451-103766473 GTGTATATATATATGCACTGTGG + Intergenic
960068202 3:113398260-113398282 AGATATACACACAAGCACTAAGG + Intronic
960517967 3:118623344-118623366 ACATATACACACAGGGACTGGGG - Intergenic
961879650 3:130052231-130052253 ATATATACACACACACACAGTGG + Intergenic
962556249 3:136555049-136555071 ATATATGCACACACGCACTCAGG + Intronic
963288419 3:143461682-143461704 ATCAATACACACATATACTGTGG - Intronic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
965819568 3:172671645-172671667 ATACATACACACATGCACACAGG + Intronic
965819570 3:172671738-172671760 ATACATACACACATGCACACAGG + Intronic
965954856 3:174357531-174357553 ATGTACACACACATGAAGAGGGG - Intergenic
965963836 3:174461824-174461846 ATGCATACACACACACAGTGTGG - Intronic
966267802 3:178067444-178067466 ACGTACACACAAATCCACTGGGG + Intergenic
966858402 3:184212843-184212865 TTGAATACACACATTAACTGGGG + Intronic
968447501 4:659168-659190 ATGTACACACACGTACACTAAGG - Intronic
970719372 4:18968328-18968350 ATGTGTACTCACATGGACAGCGG - Intergenic
972049485 4:34711113-34711135 ATATATACACACACACACTAAGG + Intergenic
972140875 4:35957890-35957912 ATTTACACACACATGCATGGTGG + Intronic
973304173 4:48625287-48625309 ATGTATACACATTTGCAAAGAGG + Intronic
974000045 4:56503621-56503643 ATGGATACATCCATTCACTGTGG + Intronic
975321913 4:73018379-73018401 AAGTGTACACACATGCACATAGG + Intergenic
976278403 4:83302058-83302080 ATGTATAGACACATGCAACAGGG + Intronic
978055487 4:104259019-104259041 ATGAATAGACACATAAACTGTGG + Intergenic
978180983 4:105795551-105795573 ATAGATACACACATGCACACAGG - Intronic
978273715 4:106922948-106922970 ATGTATTCATACATACTCTGTGG - Exonic
981328049 4:143474835-143474857 ATATATACACACACACACGGGGG - Intergenic
981437539 4:144743613-144743635 ATATATACACACATGTATTTTGG - Exonic
982016974 4:151164348-151164370 ATGTGTACACACACACACAGTGG - Intronic
982853302 4:160346791-160346813 ATGTACACACATATTCATTGTGG + Intergenic
982970948 4:161986019-161986041 ATGTAGACATACATGGAATGAGG + Intronic
983255384 4:165394334-165394356 ATCTATTCACAGAAGCACTGTGG - Intronic
983441016 4:167784942-167784964 GTGTCTACCCATATGCACTGAGG - Intergenic
984125966 4:175811086-175811108 ATGTACACACACATACTTTGAGG - Intronic
984345346 4:178515566-178515588 ATATGTACACACATGAACTGTGG + Intergenic
984582700 4:181528771-181528793 GTGTATGCACACTTGCACTAGGG - Intergenic
985096023 4:186413994-186414016 TTGTAAACACACATACAGTGTGG + Intergenic
985776481 5:1846710-1846732 ATGCATGCACACACGCACTGTGG - Intergenic
985964153 5:3326912-3326934 ACGCACACACACATGCACTTGGG - Intergenic
986299841 5:6469582-6469604 ATATATACACACACACACTAAGG + Intronic
986479087 5:8166430-8166452 ATGTACACACACATGCTGTCAGG + Intergenic
987489834 5:18565206-18565228 ATATATACACACATACACACAGG - Intergenic
987967881 5:24899640-24899662 AGGTATCCACAGATTCACTGGGG + Intergenic
988121583 5:26970450-26970472 GTGTATACATAGATGCAGTGAGG - Intronic
988535860 5:32067461-32067483 ATGTACACATACATGCACTCAGG - Intronic
988741328 5:34075901-34075923 GTGTATACACACACACACGGTGG + Intronic
988990960 5:36670645-36670667 ATTTACACACACATGCACACAGG + Intronic
989731793 5:44657522-44657544 ATGTTTACACACAACAACTGAGG + Intergenic
989791027 5:45402064-45402086 ATGTACACACACATACTATGGGG - Intronic
990409858 5:55531349-55531371 ATATACACACACATGCACACAGG + Intronic
990699237 5:58458224-58458246 AAGTACACACACATCCACTTTGG + Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991096491 5:62745244-62745266 ATGTATATGCACATGCACGTAGG - Intergenic
991442253 5:66663202-66663224 ATGTATACACACATGCACTGAGG - Intronic
991540949 5:67727512-67727534 ATATACACATACATACACTGTGG + Intergenic
991894091 5:71373944-71373966 ACACATACACACATGCACAGAGG - Intergenic
992773541 5:80070429-80070451 CAGTAGGCACACATGCACTGTGG + Intronic
994500515 5:100571657-100571679 ATATATACACACACACACTTAGG - Intronic
995630877 5:114130788-114130810 ATGTATACATACATGCTTTGAGG - Intergenic
996506601 5:124275232-124275254 ATGTAGACAGACAGGCACGGGGG - Intergenic
996705639 5:126495439-126495461 ATATATACACACACACATTGAGG - Intronic
998304216 5:141057118-141057140 ATATATACACACATACACAATGG + Intergenic
998570937 5:143257129-143257151 ATATACACACACACACACTGTGG + Intergenic
998910924 5:146959539-146959561 ATGAATAAATGCATGCACTGTGG + Intronic
999049715 5:148509455-148509477 ATGGATCCACACATGTACTAAGG - Exonic
999241306 5:150129237-150129259 ATGCATACAGACATACACTGTGG + Intronic
1003019969 6:2501296-2501318 ATGTAGAAACACATGCATAGAGG - Intergenic
1003570714 6:7254700-7254722 ATGTGTGCACATATCCACTGTGG - Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1003836786 6:10080164-10080186 ATGAAAATACAAATGCACTGAGG + Intronic
1004762486 6:18683843-18683865 ATGCATGCACACATGCACACAGG + Intergenic
1005112024 6:22293021-22293043 ATGTAAATACATTTGCACTGTGG - Intronic
1005402745 6:25451181-25451203 TTGGATACACACATGCACTGTGG - Intronic
1005664324 6:28035791-28035813 ATTTATACACACAAGCATTATGG + Intergenic
1005772517 6:29089252-29089274 ATGTATACACATCTGAACTTAGG + Intergenic
1006935604 6:37715496-37715518 ATGTCTACACACAAGCCCAGGGG - Intergenic
1007810818 6:44484586-44484608 ATGTGCACACACATGCCCTGGGG + Intergenic
1009682667 6:66919030-66919052 ATGTATACACACATAAAATCTGG + Intergenic
1011522591 6:88225746-88225768 ATGTATATACACATGATTTGGGG - Intergenic
1013635496 6:112025574-112025596 ATGGATACACAAAAGCACTCAGG - Intergenic
1015708434 6:136113218-136113240 ATATATACACACACACATTGTGG - Intronic
1017072327 6:150586620-150586642 ATGAATGCACTCATGCATTGCGG + Intergenic
1017878891 6:158546060-158546082 ATGTATAAACCCATGCTCTTCGG + Intronic
1018041539 6:159927186-159927208 ATGTATATACACACACACAGAGG - Intergenic
1018291377 6:162295419-162295441 ATGGCTACACACAGGCCCTGTGG + Intronic
1019099899 6:169621216-169621238 ATATACACACACATGCACACAGG + Intronic
1019773965 7:2901419-2901441 CTGTACACACACATTCACAGCGG - Intergenic
1020130062 7:5554825-5554847 GTGTACACACAAGTGCACTGGGG + Intronic
1020372727 7:7451668-7451690 TTGTATACATACATACACAGAGG + Intronic
1022172890 7:27846308-27846330 ATGTATACACACACACACAATGG - Intronic
1023867764 7:44246595-44246617 ATGTATACACACATGCACACAGG + Intronic
1023935708 7:44738310-44738332 CTGTATAAACACATGCAGTGGGG + Intergenic
1024045560 7:45583202-45583224 ATGCATGCACACATGCACATGGG - Intronic
1025857367 7:65294031-65294053 ATATATACACACACACACTATGG - Intergenic
1027633134 7:80633745-80633767 ATGTATACATACATACATTTAGG - Intronic
1027636198 7:80678107-80678129 GTGTGTGCACATATGCACTGTGG + Intronic
1027938000 7:84633517-84633539 ATGTATACAAACATACAGTTAGG - Intergenic
1027975660 7:85151566-85151588 ATGCATACACACATCAACTACGG - Intronic
1028181923 7:87734284-87734306 ATATAGACACACATGCACCTAGG - Intronic
1028264086 7:88701852-88701874 ATATATACACACATACACAATGG - Intergenic
1030697146 7:112598171-112598193 ATGTGTACACACACACACAGTGG - Intergenic
1030729035 7:112962315-112962337 CTATATATACACATGCACAGTGG + Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1031054707 7:116980542-116980564 TTGTAGACAAACATGCACTGAGG - Intronic
1031100770 7:117477634-117477656 ATGTACACACACATGTACATAGG - Intronic
1032340464 7:131067582-131067604 CTGTATACCCATATGCTCTGGGG - Intergenic
1032587541 7:133161386-133161408 ATGTACACACACATAAAGTGTGG - Intergenic
1034988768 7:155534319-155534341 ATGCACACACACGTGCACAGAGG + Intergenic
1035263952 7:157679068-157679090 ATGTACACACACACACACTAAGG - Intronic
1036077012 8:5513431-5513453 ATATGTACAGACAGGCACTGTGG + Intergenic
1039131827 8:34273594-34273616 CTGTGTACATACATGTACTGTGG + Intergenic
1039146737 8:34455694-34455716 ATGGACACACACATGTACTGAGG + Intergenic
1039626020 8:39054053-39054075 CTCTCTGCACACATGCACTGAGG + Intronic
1039666164 8:39531497-39531519 ATGTATACACACCTGCACAGAGG - Intergenic
1039840343 8:41288613-41288635 ATGTCTACACACCAGCTCTGTGG + Intronic
1040431918 8:47351277-47351299 ATGTTTTCAGACATCCACTGGGG + Intronic
1040470512 8:47732283-47732305 ATGTGCACACACGTGCACTCAGG - Intronic
1040939128 8:52815057-52815079 ATATATACACAATTCCACTGTGG - Intergenic
1041533039 8:58893513-58893535 ATTTACATAAACATGCACTGAGG - Intronic
1042493032 8:69423210-69423232 ATATATACACACATGTAGAGGGG - Intergenic
1043492300 8:80761807-80761829 ATGTATAAACAAAGTCACTGTGG + Intronic
1044216861 8:89622591-89622613 ATATATACACACATGCACACAGG - Intergenic
1045065295 8:98438659-98438681 ATAGATACACACATGCACACCGG - Intronic
1047405156 8:124578985-124579007 ATTTATACCCAAATTCACTGTGG + Intronic
1047657793 8:126997666-126997688 ATATATATACACACACACTGCGG + Intergenic
1047657794 8:126997706-126997728 ATATATATACACACACACTGTGG + Intergenic
1047858587 8:128939339-128939361 ACTTTTACACACATGCACTGAGG + Intergenic
1048363603 8:133718959-133718981 ATTTATACTCACTTGCAGTGGGG - Intergenic
1049916981 9:327311-327333 ATGCATACAAAGAAGCACTGTGG - Intronic
1050407160 9:5321722-5321744 CTGCCTAAACACATGCACTGTGG + Intergenic
1050414157 9:5397678-5397700 CTGCCTAAACACATGCACTGTGG + Intronic
1051069660 9:13149818-13149840 ATGTGCACACACATGCACACAGG + Intronic
1051409357 9:16773196-16773218 CTGTACACACACATGCACTATGG + Intronic
1051533758 9:18133735-18133757 ATACATACACACAAGCACAGGGG - Intergenic
1053315606 9:37048716-37048738 ATGTATGAAGACATGCACTTTGG - Intergenic
1053320530 9:37094478-37094500 ATGTATGAAGACATGCACTTTGG - Intergenic
1053448936 9:38177036-38177058 ATGTATACACACATCTTCAGAGG - Intergenic
1055425333 9:76189582-76189604 ATCCATTCACACATGCACAGGGG - Intronic
1055662573 9:78519964-78519986 ATGTATTTCCACATGCCCTGAGG + Intergenic
1056575713 9:87855015-87855037 ATATATACACACATGAGCAGAGG + Intergenic
1058057726 9:100465909-100465931 ATGCATACACACACTCACAGAGG + Intronic
1059469318 9:114492564-114492586 ATGCATACACAGATGCACACAGG + Intronic
1059532003 9:115043770-115043792 GTGTATAAACTCAGGCACTGAGG + Intronic
1059653011 9:116333108-116333130 TTGAATACCCACATGCACCGTGG + Intronic
1060510165 9:124225982-124226004 ATGTATACACATATGCATGCAGG - Intergenic
1061946479 9:133911140-133911162 ATGTATTCACGCGTGCACTGGGG + Intronic
1186178331 X:6948490-6948512 ATGTGCACACATATCCACTGGGG + Intergenic
1187035341 X:15532649-15532671 AAATATACATATATGCACTGTGG - Intronic
1187983580 X:24786063-24786085 ATGTATACACACATACAAAATGG - Intronic
1188554141 X:31392615-31392637 GTGTATGCACACATGCACACTGG + Intronic
1189207747 X:39256459-39256481 ATGAATGAACACATGCACGGGGG - Intergenic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1190936420 X:55002506-55002528 ATGTAAACATACATGCACCGTGG + Intronic
1191740994 X:64434871-64434893 ATGTATATACACACGCCTTGGGG - Intergenic
1193503044 X:82304038-82304060 ATATATACACACATACACATTGG + Intergenic
1193778057 X:85668254-85668276 ACGTACACACACATGCACAAAGG - Intergenic
1194382720 X:93215500-93215522 GTGAATACACAGATGCACTGTGG + Intergenic
1197289137 X:124633266-124633288 ATGTAAATAAACATGCACTCAGG + Intronic
1198034481 X:132787140-132787162 ATATATACACACACACACTTTGG - Intronic
1198205180 X:134459232-134459254 ATGTATATATATATGCACTTAGG - Intergenic
1198986205 X:142456873-142456895 AAGCACACACACATGCACAGAGG + Intergenic
1199949382 X:152695176-152695198 ATATATATACACACGCACTATGG + Intergenic
1199960294 X:152773273-152773295 ATATATATACACACGCACTATGG - Intergenic
1200304840 X:155013860-155013882 CTCTCTACACTCATGCACTGAGG - Intronic
1201715639 Y:17042074-17042096 GTGTATACACACACACTCTGTGG + Intergenic