ID: 991446377

View in Genome Browser
Species Human (GRCh38)
Location 5:66704433-66704455
Sequence CTTTCAACAGAGATGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991446377 Original CRISPR CTTTCAACAGAGATGAAGGA TGG (reversed) Intronic
901353241 1:8617750-8617772 CTTTCAGCAAAGATAAATGAGGG - Intronic
901363325 1:8723048-8723070 CTTTCAACAGAGAAAAGAGAAGG + Intronic
901549477 1:9984935-9984957 CTAACAACAGAGTAGAAGGAAGG + Exonic
902376869 1:16034059-16034081 CTTGCAGCTGAGATGAGGGATGG - Intergenic
902382036 1:16057317-16057339 CTTGCAGCTGAGATGAGGGATGG - Intergenic
902667368 1:17948889-17948911 CATTCATCAGTGATGCAGGAAGG + Intergenic
902874659 1:19333570-19333592 CTTTCATCGGAGCTGAATGACGG + Intergenic
905784182 1:40739847-40739869 CATTCACCAGATGTGAAGGATGG + Intronic
906001008 1:42424923-42424945 ATTTGAAGAGAGATGAAGGGTGG - Intergenic
907169725 1:52451431-52451453 CTAACAACAGAAATGAAAGAGGG + Intronic
908941210 1:69436687-69436709 CTTTCAACAGCTATGAGGGAGGG - Intergenic
909385842 1:75055464-75055486 CATTTAAGAGATATGAAGGATGG + Intergenic
910285492 1:85549669-85549691 CTTCCATCAGTGATGAAGAAAGG + Intronic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910979129 1:92941440-92941462 CTGTCAACAGAACTGAAAGAAGG - Intronic
911192153 1:94958892-94958914 TTTTCAACAGAAATAAATGATGG + Intergenic
911548821 1:99254832-99254854 CTATCAAAAGAGCTGAAGCAAGG - Intergenic
911628854 1:100159391-100159413 GTTTCAGCAGAGAAGAAGGGAGG + Exonic
916306845 1:163345725-163345747 CTTCCAACTGACATGAAGGCAGG - Exonic
917053142 1:170947898-170947920 GTTTCCACAGTGATGATGGAAGG - Intronic
917514985 1:175699717-175699739 CTTACAACAGAGATTGTGGAAGG + Intronic
918992465 1:191715384-191715406 CTTTCGAGAGGGATGCAGGAGGG - Intergenic
919618859 1:199841954-199841976 TTTTCACCAGTGATGGAGGACGG - Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921834511 1:219763895-219763917 CTTATAAAAGAGAGGAAGGAAGG + Intronic
1063288513 10:4715887-4715909 CTGACAACAGTTATGAAGGATGG - Intergenic
1063631394 10:7736990-7737012 CTTTCAACAAAATTGAAGAAGGG - Intronic
1064719121 10:18210410-18210432 CTTTGAACAAAGGTGAAGAATGG + Intronic
1067041700 10:42956638-42956660 CTTTCAACAGGGATCTAGCAGGG - Intergenic
1067320282 10:45212835-45212857 CTAACAACAGAAATGAAAGAAGG + Intergenic
1067547001 10:47199521-47199543 CTTTAATTAGAGATGAAGGCAGG + Intergenic
1068742019 10:60484150-60484172 CATTCAACAGAGATCTAAGATGG + Intronic
1069278833 10:66627595-66627617 CTTTCAACAAAGTTGAAAGCTGG + Intronic
1070444387 10:76481377-76481399 TTTTTGACAGAGATGAAGGCTGG + Intronic
1070513936 10:77186214-77186236 CTTGTAGCAGAGATGAAGAATGG - Intronic
1073345825 10:102782185-102782207 CTTTCAACAGAGATGGTTGGGGG - Intronic
1073992458 10:109277915-109277937 CTTTCAACAGAGATGTCTGTAGG - Intergenic
1075392664 10:122103787-122103809 CTTGCAGGAGAGAGGAAGGATGG + Intronic
1076207935 10:128618085-128618107 GTATCAACAGAGAAGAAGGGAGG - Intergenic
1077268537 11:1664529-1664551 ATTTGACCAGAGAGGAAGGAAGG + Intergenic
1077272342 11:1687089-1687111 ATTTGACCAGAGAGGAAGGAAGG - Intergenic
1077372677 11:2190827-2190849 CTTTTAACAAGGAGGAAGGAAGG + Intergenic
1077820629 11:5736401-5736423 ATTTCTAAAGAGATGAAGAAAGG + Intronic
1078820697 11:14878129-14878151 CTTTCAGCACAGATGAGGTAGGG + Exonic
1079089608 11:17471363-17471385 AGTTCAACAGAGAAGGAGGAAGG + Intronic
1079154249 11:17929707-17929729 CTTGCAAAAGACCTGAAGGAAGG - Intronic
1079848012 11:25494737-25494759 CATCCAACACAGAAGAAGGATGG + Intergenic
1080161239 11:29179438-29179460 CTTTCCTCAGAGATGCAGTAGGG - Intergenic
1080297062 11:30742356-30742378 ATTTTAGCAGAGAAGAAGGAAGG - Intergenic
1080352838 11:31405020-31405042 CTTTCAGGAGAGTAGAAGGAGGG + Intronic
1085658725 11:78342269-78342291 ATTTCAACAGAGAGTAAGGCTGG - Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1088428984 11:109736598-109736620 CTGTGAAGAGAGATGAAGAATGG + Intergenic
1089401980 11:118169558-118169580 CTTGCAACAGACAAGAAAGAGGG + Intronic
1089594568 11:119569111-119569133 ATTTCAACAGAGCTTGAGGACGG + Intergenic
1089656480 11:119950663-119950685 CTTTCATCAGAGATGGCAGAAGG + Intergenic
1090052404 11:123391175-123391197 CTGTCAGCTGAGATGAAGTAGGG - Intergenic
1090375654 11:126286984-126287006 CTTTCAAGAGGGAGGCAGGAAGG - Intronic
1091214015 11:133889078-133889100 CTTTGAACAGAGACAAAGAAAGG + Intergenic
1091398730 12:170308-170330 CTTCCAAAAGAGAGGCAGGAAGG - Intronic
1091554524 12:1562449-1562471 CTTTCTACAGTGCTGCAGGATGG + Intronic
1091858637 12:3759029-3759051 CTTTAAACAGAGATGCATGGAGG - Intronic
1092872416 12:12817744-12817766 GTTTCTTCAGAGATGAAGAAAGG + Intronic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1093440447 12:19189354-19189376 GTGTCAGCAGAGATGGAGGAAGG + Intronic
1093688739 12:22085496-22085518 TTTTTTACAGTGATGAAGGAAGG - Intronic
1094815630 12:34180788-34180810 CTTGCAGTTGAGATGAAGGAAGG - Intergenic
1095477850 12:42604025-42604047 CGTGAAACAGAGGTGAAGGATGG - Intergenic
1095900615 12:47324499-47324521 TTTTCAAAAGAGATGAAGTAAGG - Intergenic
1096728961 12:53590623-53590645 CTCCCAACAGAGAAGAAGAAAGG + Intronic
1097969106 12:65613237-65613259 TTTTCACCAGCAATGAAGGAGGG - Intergenic
1098698627 12:73593018-73593040 CTGTCAAAAGAGCTCAAGGAAGG - Intergenic
1100088333 12:90938428-90938450 TTTTCAACATAGCTGGAGGATGG + Intronic
1100231536 12:92613316-92613338 CTTTCAACAGATATTAATGGAGG - Intergenic
1100576502 12:95896492-95896514 CTTGCACCAGGGCTGAAGGAAGG - Intronic
1101234682 12:102776478-102776500 CTTCCAAGAAAGATGATGGAGGG - Intergenic
1102106939 12:110333357-110333379 CTTTCAAAAGGGAGGAAGGCAGG - Intronic
1103146975 12:118603331-118603353 TTCTCAACTGAGTTGAAGGAGGG + Intergenic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1105384058 13:19913858-19913880 CTATCAACATAGATGCAGGCAGG - Intergenic
1106356888 13:28991770-28991792 CTTTAAACAAAGGGGAAGGAGGG - Intronic
1107981844 13:45741469-45741491 CTTTAAACAGACATAAAGTAAGG + Intergenic
1109609376 13:64743345-64743367 ATTTTAACAGAAATGAAGAATGG - Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1115705060 14:35990187-35990209 GTTTGAACAGAGATTAAGGATGG + Intergenic
1115777030 14:36726921-36726943 CTTCTAAAAGAGAGGAAGGAGGG + Intronic
1117661694 14:58013124-58013146 GCTTCAACAGACAGGAAGGAAGG + Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1118872899 14:69758284-69758306 CCTACATCAGAAATGAAGGAGGG - Intronic
1119217996 14:72884051-72884073 CCTTCAACTGAGATGACTGAGGG - Intronic
1119967846 14:78936868-78936890 CTCTCATCAAAGATGTAGGATGG + Intronic
1120125920 14:80743111-80743133 CTTTCAACAGATAGAAAGGCAGG - Exonic
1120344064 14:83261739-83261761 CTATTATCAGAGATGAAGGTGGG - Intergenic
1120930712 14:89845600-89845622 CTTACAAGAGAGCTGAAGAATGG - Intronic
1122370969 14:101228755-101228777 CTTTCTGCAGAGAGCAAGGAAGG - Intergenic
1122730062 14:103789947-103789969 CATTCAAAAGAAATGAAGGCCGG + Intronic
1123634399 15:22289437-22289459 CTTTCAGCAAAGATAAATGAGGG + Intergenic
1125122119 15:36173662-36173684 CTTAAAACAGAGATGAGGAAGGG - Intergenic
1126531471 15:49715475-49715497 CCTTCAGCAGAGAGGAAGAAGGG - Intergenic
1126648953 15:50902691-50902713 CTTTAAACAGAAAAGGAGGAGGG - Intergenic
1126725951 15:51632662-51632684 CTTTTAGCAGAGATGATAGATGG - Intergenic
1127460928 15:59198354-59198376 CCTTCAACAGAGATGACAGCAGG + Intronic
1127556190 15:60089708-60089730 CTTCCCACAGATGTGAAGGAAGG + Intergenic
1127623106 15:60753286-60753308 CCTGTAACAGAGATGAAAGACGG - Intronic
1128688551 15:69705844-69705866 CTTATAACAGAGAAGAAGGCCGG + Intergenic
1129947441 15:79551611-79551633 CTCTCAGCAGTTATGAAGGAGGG + Intergenic
1130858062 15:87859097-87859119 AGTTCAACAGAGATGTAGAAAGG - Intergenic
1130903955 15:88227067-88227089 CTGTGGACAGAGATGAACGATGG + Intronic
1133951317 16:10396050-10396072 AGTTCAACAAAGTTGAAGGATGG + Intronic
1134012227 16:10863384-10863406 CTGGCTTCAGAGATGAAGGAAGG - Intergenic
1134013766 16:10874322-10874344 GTTTCAACAGAGAGGAAGCCTGG + Intergenic
1135316660 16:21452407-21452429 CTGACATCAGAGATGAGGGAAGG - Intergenic
1135369583 16:21884652-21884674 CTGACATCAGAGATGAGGGAAGG - Intergenic
1135442231 16:22486475-22486497 CTGACATCAGAGATGAGGGAAGG + Intronic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1136313327 16:29431107-29431129 CTGACATCAGAGATGAGGGAAGG - Intergenic
1136326770 16:29532873-29532895 CTGACATCAGAGATGAGGGAAGG - Intergenic
1136441461 16:30272857-30272879 CTGACATCAGAGATGAGGGAAGG - Intergenic
1137586038 16:49664502-49664524 GATTCTACAGAGATGGAGGAGGG + Intronic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1139385223 16:66564109-66564131 CTTTCTACTGTGAAGAAGGAAGG + Intronic
1139888255 16:70226598-70226620 CTGACATCAGAGATGAGGGAAGG - Intergenic
1140236287 16:73161886-73161908 CTTTCAACTGAGAAGAAGAGGGG + Intergenic
1140646791 16:77039431-77039453 CTTGCAGCAGAGATGATGGGTGG + Intergenic
1143942350 17:10555787-10555809 CTTTCAACAGCTCTGAAGTACGG + Intergenic
1145281906 17:21474269-21474291 TTTTCAAAAGAAATGATGGATGG - Intergenic
1146833886 17:36094341-36094363 CTTTAAAAAGAAAGGAAGGAAGG + Intergenic
1150721764 17:67619653-67619675 CTTTGATCAGAGATGAAGGTGGG - Intronic
1152508201 17:80767029-80767051 CTTTCATCAGAAATGAAAGAGGG + Intronic
1155602205 18:27562522-27562544 ATTTAAACAGATATCAAGGATGG + Intergenic
1156495667 18:37523838-37523860 CAGTCAACAGAGGTGAAGGTGGG + Intronic
1156566325 18:38195656-38195678 CTGTAAACAGAAATCAAGGAAGG - Intergenic
1156786029 18:40916435-40916457 TTTTCAACAGAGATTGAGAAGGG + Intergenic
1160744130 19:702716-702738 CATTCAGCAGAGAGGCAGGAAGG + Intergenic
1161660335 19:5541836-5541858 CTTTCTGCAGAGAGGAAGGGAGG + Intergenic
1167055625 19:47110305-47110327 CTTTCTTCAAAGATGAAGGCTGG + Intronic
1167349934 19:48968258-48968280 CTTTCACCAAAGCTGAAGGCAGG + Exonic
1167889571 19:52528568-52528590 ATGTACACAGAGATGAAGGACGG + Intronic
1168034103 19:53705274-53705296 CTTCCATCAGACATGGAGGATGG + Intergenic
925277024 2:2657398-2657420 CTCTCAACAGAGATGCTGGTGGG - Intergenic
927236262 2:20878493-20878515 ATTTCAAGAGAGTAGAAGGATGG + Intergenic
928038915 2:27853885-27853907 CTTTCAACAGAGTTCAGGAAAGG + Intronic
928296789 2:30090635-30090657 CTTCCTCCAGTGATGAAGGAAGG - Intergenic
930946451 2:57082855-57082877 GTGTCAACAGAGATTAAAGAGGG - Intergenic
931797937 2:65729547-65729569 CGTTCACCAGAGAGGAAGGTGGG - Intergenic
932880822 2:75500239-75500261 TTTTCAACAAAACTGAAGGAAGG + Intronic
933560059 2:83877216-83877238 CTTATAACAGAGATTGAGGAGGG + Intergenic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
934881622 2:97986538-97986560 TTTTGAAGAGAGATGTAGGAAGG - Intronic
934933425 2:98446376-98446398 CTTTGAAGAAAGATGAATGATGG + Intronic
935797729 2:106661677-106661699 TTTTCAACATAGCAGAAGGATGG - Intergenic
936228990 2:110682901-110682923 CTAGTAACAGAAATGAAGGAGGG - Intergenic
939400452 2:141685636-141685658 CTTACAACAGGGATGTAGAAAGG + Intronic
939444104 2:142286874-142286896 TTTCCAACAGAGGTGTAGGATGG - Intergenic
940066005 2:149630204-149630226 CTTTCAAGAGAGATGAGTGGAGG + Intergenic
940389250 2:153112239-153112261 CTTTCAAAAGAAATAAAGGAAGG - Intergenic
940810866 2:158241458-158241480 CTTTAAACAGAGATGAGAAAGGG + Intronic
941272345 2:163446177-163446199 CTTTCAAAAAAGATGAATGCAGG - Intergenic
941865135 2:170326579-170326601 ATGTCAATAGAGATGATGGAGGG - Intronic
942501400 2:176594445-176594467 CTTTCTACAGAGCTGATTGAAGG + Intergenic
943434388 2:187846408-187846430 CTTAAAACAGAAATGAAGAAAGG + Intergenic
943797555 2:192016087-192016109 CTTTAAACAGAGAACAATGATGG + Intronic
944478048 2:200126985-200127007 TTTTCAACAGAGATGGCAGATGG + Intergenic
944515913 2:200511441-200511463 CCTTCTGCAGAGATGGAGGAAGG + Intronic
945672055 2:212814075-212814097 CTTGCATCAGAGATGAAGCCTGG - Intergenic
947701965 2:232242159-232242181 CTTTAAACAGAGATGTTGGCTGG + Intronic
948384776 2:237574705-237574727 CTCTGGACAGAGAGGAAGGAAGG - Exonic
1168779160 20:473951-473973 CTGTCAACAAAGAGGAAGGGAGG + Intronic
1169278843 20:4250343-4250365 CTTTTAACAGGGAGGATGGAAGG + Intergenic
1169997335 20:11572976-11572998 CTTTCTCTAGTGATGAAGGAGGG - Intergenic
1170039081 20:12021262-12021284 CTTACAAAAGAGATTATGGAAGG + Intergenic
1170499120 20:16956656-16956678 CTTCCAACAGTGAGGAAGCAAGG + Intergenic
1171384418 20:24759676-24759698 CTAACATCAGAAATGAAGGAGGG + Intergenic
1171510006 20:25674540-25674562 GTTTCAACATAAATTAAGGAGGG + Exonic
1172639630 20:36432895-36432917 CTCTCAACAGAGATTAATTAGGG + Intronic
1173847780 20:46198995-46199017 CTATCAACAGAGAGAAAGCACGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1178791444 21:35704090-35704112 CTTTGAACAGTCATGAAGTATGG - Intronic
1180067622 21:45420527-45420549 CTGACAGCAGGGATGAAGGAGGG - Intronic
1180216488 21:46326683-46326705 CTTTCAAAAGTGAGGAAAGAGGG + Intronic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1181322875 22:22022344-22022366 GTGTGAACAGAGATGATGGATGG + Intergenic
1183313050 22:37121828-37121850 CATTCAACAGACATTTAGGAGGG - Intergenic
949482866 3:4510715-4510737 CTTGTAACTGAGATGAAGGCTGG + Intronic
952601045 3:35083541-35083563 CTTAAATCAGAGATGAAGTATGG - Intergenic
953097189 3:39789853-39789875 CTTTCTCCTGAAATGAAGGAAGG + Intergenic
953983773 3:47426261-47426283 CTTTCAACACAGGGGCAGGAGGG - Intronic
954814316 3:53268683-53268705 GTTTCACCAGTGATGAATGAGGG + Intergenic
954982323 3:54757533-54757555 ATTTTAAGAGAGGTGAAGGAAGG + Intronic
955015896 3:55068368-55068390 CTTCCTATAGAGAAGAAGGAAGG - Intronic
955439222 3:58937497-58937519 CTTTCAAGAGAGGGGAAGGAAGG + Intronic
955888610 3:63626640-63626662 GTTCCAAAAGAGATGAAGGCAGG + Intergenic
956308669 3:67854705-67854727 CTGCCTACAGGGATGAAGGAAGG - Intergenic
956846866 3:73191950-73191972 CTTTCAATAGAGATTACTGAGGG - Intergenic
958534956 3:95388322-95388344 CTTTCAACTGTGATGTAGTAAGG + Intergenic
958867355 3:99516815-99516837 ATTTCAACAGATACCAAGGAAGG - Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG + Exonic
962263632 3:133930268-133930290 CTTTCATCAGAGATTAAATATGG - Intergenic
962660096 3:137593341-137593363 CTTTCCACAGAGCCCAAGGAAGG - Intergenic
964101785 3:152996130-152996152 CTGTCAAAAGAAAGGAAGGAAGG + Intergenic
964378309 3:156071307-156071329 CTTTCCACAGACAGGAAGGGGGG - Intronic
965071757 3:163923936-163923958 CATTGGACAGAGATGAAGGCTGG - Intergenic
969091092 4:4694457-4694479 CTTTAAACAGACGCGAAGGAAGG - Intergenic
970354807 4:15241079-15241101 TGTACAACAGAGAGGAAGGAAGG + Intergenic
970596780 4:17607671-17607693 CTTTTAACGGAGACAAAGGATGG + Exonic
971297150 4:25405992-25406014 CTTTCTAAAGAAAGGAAGGAAGG + Intronic
972000367 4:34024294-34024316 TTTTGAACAGACATGAAGTAGGG + Intergenic
972713061 4:41617931-41617953 CTTCCAACAGCTATGAAGTAGGG + Intronic
974156093 4:58074731-58074753 ATTTCAAAAGAGAAGAAGGGAGG + Intergenic
976635054 4:87279195-87279217 CTTTCAAATGAGCTGAAGGCTGG - Intergenic
977300556 4:95262232-95262254 CTTTCATCAAAACTGAAGGAGGG + Intronic
978309529 4:107371084-107371106 CTAGCATCAGAAATGAAGGAGGG + Intergenic
980779430 4:137478287-137478309 CTTAAAACAGAGATTAAGGAAGG - Intergenic
982018321 4:151177720-151177742 ATTGAAACAGAGATGAAGTAAGG - Intronic
984162321 4:176268688-176268710 ATTGCAAAAGAGATTAAGGAAGG - Intronic
987991810 5:25222380-25222402 GGTTCAAGAGAGATTAAGGAAGG - Intergenic
989098043 5:37798999-37799021 TTTTTAACAGAGAAGATGGAGGG + Intergenic
990837111 5:60034495-60034517 CTTTTAAGAGAGAGGCAGGAAGG - Intronic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
993141913 5:84044834-84044856 ACTTCAACAGAGATGAGGGTGGG + Intronic
993636360 5:90349067-90349089 TCTTCAGCACAGATGAAGGAAGG - Intergenic
994284228 5:97944456-97944478 CTTGCAACAGAGAGGAAAGGGGG + Intergenic
994327994 5:98471475-98471497 CTTTCAACTTAAATGTAGGAAGG + Intergenic
996236164 5:121132826-121132848 CATTAAAAAGAGAGGAAGGAGGG + Intergenic
998793598 5:145793159-145793181 CCTTTAAGAGTGATGAAGGAAGG + Intronic
998914614 5:147000353-147000375 CTTTAAACAGAGAGGCAGTAGGG + Intronic
999912114 5:156213573-156213595 CTTTCAAAAAAGCTGAAGAAGGG + Intronic
1000189935 5:158900432-158900454 CTGTCATCGGAGATGGAGGAGGG + Intronic
1000892541 5:166816633-166816655 TATTCAACAAAAATGAAGGAAGG - Intergenic
1000956993 5:167555005-167555027 CTTTCCAGAGAGATGAGTGATGG - Intronic
1001239872 5:170060435-170060457 AATTCAACAGAGATGGAGGAGGG - Intronic
1002694018 5:181071979-181072001 GTTTCAACACATATCAAGGATGG + Intergenic
1003091277 6:3105686-3105708 CTTACAACAGAGAGGAGGAAAGG + Exonic
1004208004 6:13610395-13610417 CTTTCAATAAAGTTGAAAGAGGG - Intronic
1004422781 6:15486691-15486713 GTGACAACAGAGATGAAGAAAGG - Intronic
1004573164 6:16867715-16867737 CTTTCATCAAAAATGAATGATGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1005018483 6:21395689-21395711 CTTTGAATGGAGATGAAAGATGG + Intergenic
1006254612 6:32820482-32820504 CTTCCCTCAGAGCTGAAGGAAGG + Intronic
1006415121 6:33899133-33899155 CTTTCAACAAGGGTGTAGGATGG + Intergenic
1006691018 6:35885507-35885529 ATTTGAACAGAGAAGCAGGAAGG - Intronic
1006795286 6:36728529-36728551 TTATCAGCAGAGAGGAAGGATGG + Intronic
1008515462 6:52314661-52314683 GTTTCAATGGAGAGGAAGGATGG + Intergenic
1008768660 6:54951654-54951676 TTTTCAACAGAGATGTAAAATGG + Intergenic
1010991208 6:82482316-82482338 CTCTCAAGAGAGAAGGAGGAAGG - Intergenic
1011068134 6:83351364-83351386 CATTCAACAGAAAAGAAAGAGGG + Intronic
1011493629 6:87917297-87917319 GTTTCAACAGAAAGGAAAGAAGG - Intergenic
1012546522 6:100425460-100425482 TTTTGAACAGAGAAGCAGGAAGG - Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014271868 6:119345433-119345455 ATTTTAACAGAGGTGAAGGGAGG + Intronic
1015025939 6:128532550-128532572 CTGACAACAGGGATGTAGGATGG - Intergenic
1016685419 6:146876541-146876563 TTTTCAACAGACATGAGGGATGG + Intergenic
1017489715 6:154934360-154934382 GTTTCAAAAGAAAGGAAGGATGG + Intronic
1017957133 6:159188094-159188116 CTTCAAACAAAGATGAAGTAGGG + Intronic
1018414564 6:163590176-163590198 CTCTCAACAGAGCAGAGGGAGGG - Intergenic
1019532365 7:1510247-1510269 TTTTTAAAAGACATGAAGGAAGG - Intergenic
1022855254 7:34307877-34307899 CTTTCAACAGAGAAAATTGAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025806410 7:64838002-64838024 CTTATAACAGAGATTGAGGAGGG + Intergenic
1026461134 7:70616056-70616078 CTTTTAGCAGAGATAAAGGAGGG + Intronic
1027931728 7:84545681-84545703 CTTTCAACAAAATTGAAAGATGG - Intergenic
1028170035 7:87585081-87585103 CTATCAACAGAAATGAGAGATGG - Intronic
1028261499 7:88672363-88672385 CTGATAATAGAGATGAAGGAGGG + Intergenic
1029880723 7:103806815-103806837 CTTTCAAGATAGATGAAGCCAGG + Intronic
1030526852 7:110664646-110664668 CCTTCAACAGGTCTGAAGGAGGG + Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031759837 7:125698907-125698929 CTTTTAACAGGGAGGCAGGAGGG - Intergenic
1032349832 7:131150886-131150908 CTTTCAAAATAAATGAAGAAGGG + Intronic
1033865035 7:145679820-145679842 TTTCCAAAAGAGATGATGGATGG + Intergenic
1034025318 7:147697174-147697196 CTGTTAACAGAAATGAAGAATGG - Intronic
1034733937 7:153411994-153412016 CTTATAACAGAGATTGAGGAGGG + Intergenic
1035076098 7:156178644-156178666 ATTTCAACAGACAGCAAGGAAGG - Intergenic
1038410541 8:27355248-27355270 CTTTTAAGAGAGAGGCAGGAAGG + Intronic
1039216532 8:35278109-35278131 CTTTCACCAGGAATGAAGGATGG - Intronic
1040066097 8:43145266-43145288 CTAACAACAGAGTAGAAGGAAGG - Intronic
1041963096 8:63642586-63642608 CAGTCGCCAGAGATGAAGGAGGG - Intergenic
1042173475 8:66015704-66015726 CTTTCCACTGAGCTGCAGGAAGG + Intergenic
1042657535 8:71116269-71116291 CATTGAACAGAGTTGAAAGATGG - Intergenic
1043637089 8:82399316-82399338 TTTTCAAAAGACATGAAAGATGG + Intergenic
1046088423 8:109467642-109467664 ATTTCTAGAGAGATGATGGATGG - Intronic
1046800561 8:118422102-118422124 TTATCAACAGAAATGAAGAAAGG + Intronic
1046802737 8:118447278-118447300 ATTTCAACTGAGGGGAAGGAAGG - Intronic
1049050456 8:140190718-140190740 CTTTCTAGAGTGAGGAAGGAGGG - Intronic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1051310467 9:15765606-15765628 CTATCAATTGAGATGGAGGAAGG + Intronic
1052684965 9:31744079-31744101 CTTATAAGAGAGAGGAAGGAGGG - Intergenic
1053440689 9:38113846-38113868 CTTTCAAAAGGAATGAAGGCCGG - Intergenic
1055149256 9:72975790-72975812 CTTTCACTAGAGATGAGAGAAGG - Intronic
1055372423 9:75614294-75614316 CTTTCCACAGACATGAAAGGTGG + Intergenic
1055825939 9:80324832-80324854 CCTTGAACAGATATGTAGGAAGG - Intergenic
1056032364 9:82566362-82566384 CTATCATCAGAGATGAGAGATGG - Intergenic
1057158901 9:92870876-92870898 CTGTCAACAGAGTTCAAGTAGGG + Intronic
1057288029 9:93776478-93776500 CTTCCACCAGCAATGAAGGAGGG - Intergenic
1058588524 9:106535794-106535816 CATCCAACACAGATGAAGGTAGG + Intergenic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1060263655 9:122096413-122096435 CTAAGAACAGACATGAAGGAAGG - Intergenic
1060830432 9:126710995-126711017 TTTTGGAGAGAGATGAAGGAAGG + Intergenic
1061278024 9:129580773-129580795 CTTGTAACAGAGAGGCAGGAAGG - Intergenic
1185885877 X:3782324-3782346 ATTTCAAGAGAGCTGAAGGGTGG + Intergenic
1185993759 X:4920906-4920928 CTTTCATAAGAGCTCAAGGATGG + Intergenic
1186427208 X:9472014-9472036 GTTTCAACAGACCCGAAGGAAGG - Intronic
1188139904 X:26537076-26537098 GCTTCAAAAGAGATGAAGAAGGG - Intergenic
1188491781 X:30745507-30745529 CCTTCAGCAGAACTGAAGGAAGG - Intergenic
1188752616 X:33922836-33922858 CATAGAACAGAGATGAAGGGTGG - Intergenic
1194385650 X:93251078-93251100 CTCTCAATATAGAAGAAGGATGG - Intergenic
1194844561 X:98788606-98788628 CTCTCAACAAAGGTGAATGAAGG + Intergenic
1195637224 X:107131956-107131978 CTTCTGACAGAGAAGAAGGAAGG + Intronic
1197769554 X:130081578-130081600 CTGGCAACAGAGCTCAAGGAAGG - Intronic
1199249724 X:145646636-145646658 CATTGAACAGATAGGAAGGACGG - Intergenic
1200211204 X:154347302-154347324 CTCTCAACAGGGGTCAAGGAGGG + Intergenic
1201770277 Y:17611856-17611878 CTTATAACAGAGATTGAGGAGGG - Intergenic
1201831277 Y:18294131-18294153 CTTATAACAGAGATTGAGGAGGG + Intergenic
1202305787 Y:23469098-23469120 CTTTCAGCAAAGATAAATGAGGG + Intergenic
1202565022 Y:26201491-26201513 CTTTCAGCAAAGATAAATGAGGG - Intergenic