ID: 991452057

View in Genome Browser
Species Human (GRCh38)
Location 5:66762444-66762466
Sequence TGGGGGGATTTGGAGTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991452049_991452057 17 Left 991452049 5:66762404-66762426 CCAGGCAGCTGTTAGTATTATGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG 0: 1
1: 0
2: 1
3: 22
4: 235
991452048_991452057 18 Left 991452048 5:66762403-66762425 CCCAGGCAGCTGTTAGTATTATG No data
Right 991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG 0: 1
1: 0
2: 1
3: 22
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991452057 Original CRISPR TGGGGGGATTTGGAGTTGAT GGG Intronic