ID: 991452057

View in Genome Browser
Species Human (GRCh38)
Location 5:66762444-66762466
Sequence TGGGGGGATTTGGAGTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991452048_991452057 18 Left 991452048 5:66762403-66762425 CCCAGGCAGCTGTTAGTATTATG 0: 1
1: 0
2: 1
3: 5
4: 154
Right 991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG 0: 1
1: 0
2: 1
3: 22
4: 235
991452049_991452057 17 Left 991452049 5:66762404-66762426 CCAGGCAGCTGTTAGTATTATGT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG 0: 1
1: 0
2: 1
3: 22
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991452057 Original CRISPR TGGGGGGATTTGGAGTTGAT GGG Intronic
900395200 1:2450615-2450637 GGGGGGGAGTTGGAGTTGGAGGG - Intronic
900903119 1:5530471-5530493 TGCGGGGTTTCGGACTTGATTGG + Intergenic
901882485 1:12202348-12202370 AGGGAGGATTTTGAGGTGATAGG - Intronic
902205281 1:14863929-14863951 TGGGGGGATGTGCAGCTGAAAGG + Intronic
902232233 1:15035444-15035466 TGGGGTGAATAGGAGTTTATGGG + Intronic
903903345 1:26665055-26665077 TTGGGGGATTTGGTGGTGAGAGG + Intergenic
904271438 1:29352932-29352954 GGGGGGGAGTGGGAGTTGAGGGG + Intergenic
905767337 1:40612352-40612374 AGGGTAGATTTGGAGTTGAAAGG - Intergenic
905806938 1:40884211-40884233 TATGGGGATGCGGAGTTGATGGG + Intergenic
906287127 1:44594750-44594772 TTGGGGAATTTGGATTGGATTGG + Intronic
907106575 1:51888298-51888320 TGGGGGGATGTGGGGTTGGGGGG + Intergenic
908113092 1:60916333-60916355 TGGGGTCATTGGGAGGTGATTGG - Intronic
908395280 1:63719743-63719765 TGGGGGCATGGGGAGGTGATGGG + Intergenic
910059023 1:83066829-83066851 AGGGTAGATTTGGAGTTGAGAGG - Intergenic
910772062 1:90840837-90840859 TGGTGGGACTTGGAGTAGAGCGG - Intergenic
912037410 1:105335735-105335757 TGGGGGAATTGGGAATTGGTAGG + Intergenic
912233919 1:107827947-107827969 TGGGTGGATGTATAGTTGATAGG - Intronic
914460987 1:147885021-147885043 TGGTGGGATGGGGAGTTGGTGGG - Intergenic
918162131 1:181911223-181911245 TTGGGGGATTTGGGGTGGAGGGG - Intergenic
918285238 1:183047717-183047739 TGTGGGGAATTGGAGGGGATGGG + Intronic
920095141 1:203481853-203481875 TGGTGGGGTCTGGAGTTGATTGG + Intronic
922683259 1:227618318-227618340 TGGGGGAATTGGGAGATGAGAGG + Intronic
923091136 1:230742155-230742177 TGGGGGTAGGTGGAGTAGATGGG - Intergenic
1062895189 10:1097747-1097769 TGTGGGGTTTTGGACTTGCTTGG + Intronic
1065500095 10:26372455-26372477 AGGGTGGATTTGGAATTGAGAGG - Intergenic
1067394738 10:45904276-45904298 TGGGGGGACTTTCAGTTGTTTGG + Intergenic
1067682988 10:48451895-48451917 TGGGGGGATTTGGGGAGGCTGGG - Intronic
1067863061 10:49873407-49873429 TGGGGGGACTTTCAGTTGTTTGG + Intronic
1068968172 10:62934356-62934378 TGGAGGCATTTGGAGTTCACAGG + Intergenic
1072286213 10:93917951-93917973 TGGGGGCATTTGGAGATGGGAGG + Intronic
1072812596 10:98474934-98474956 TGGGGTGTTTTGGGGTTGTTGGG - Intronic
1073031942 10:100533525-100533547 TGGGGGGATTTGGTAGAGATGGG + Intronic
1074549112 10:114426881-114426903 AGGTGGCATTTGGACTTGATGGG + Intergenic
1076650729 10:131985448-131985470 AGGGGGGCTTTGGAATTGACCGG + Intergenic
1076778898 10:132713341-132713363 CAGGGGGAGTTGGAGCTGATGGG + Intronic
1077422385 11:2459030-2459052 TGGGAGGCTTTGGGGTTGTTGGG + Intronic
1078265015 11:9748739-9748761 AGGGTGGATTTGGAGTGGAGAGG + Intronic
1078591045 11:12641030-12641052 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591061 11:12641070-12641092 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591070 11:12641090-12641112 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591079 11:12641110-12641132 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1078591127 11:12641231-12641253 GGGGGGGATGTGGAGGTGGTGGG - Intergenic
1084370799 11:68741442-68741464 TGGGGGGATGGGGATTTGATGGG - Intronic
1087422207 11:97943754-97943776 TGCGAAGATTTGGAGTTGCTTGG + Intergenic
1087654634 11:100907538-100907560 TGGAGAGATTAGGAGTTGTTGGG + Intronic
1090579806 11:128147610-128147632 AGTGGGGATTTGTAGTTTATAGG + Intergenic
1092303314 12:7273470-7273492 TGGGGGCATTAGGTGTGGATGGG + Intergenic
1093369073 12:18344302-18344324 TGGTGGGAATTAGAGTTGAGAGG - Intronic
1097451758 12:59744942-59744964 TGGGGGGATCTAGAGTACATGGG - Intronic
1100615751 12:96230619-96230641 TGGAGGGATTCAGAGTTGCTGGG + Intronic
1101678238 12:106939298-106939320 TGGGGGGATTAGGGGGTGAGAGG + Intergenic
1103201808 12:119093914-119093936 TGGGTGGATGTGGGGTTGATTGG + Intronic
1103216243 12:119203435-119203457 TAGAGGGAGTTGGAGGTGATGGG - Intronic
1104279682 12:127363683-127363705 TGGGTGGAGTTGGAGCTGACAGG + Intergenic
1105374046 13:19827077-19827099 TTGGAGGAGTTGGAGTTGAAAGG + Intronic
1105546786 13:21356416-21356438 TGGGAGAAGTTGGAATTGATTGG + Intergenic
1106086098 13:26543129-26543151 TGGGGTGATGTGGAGGTGGTGGG + Intergenic
1107242010 13:38247520-38247542 TGGGAGGATTGGGATTTGAGAGG - Intergenic
1108378584 13:49836245-49836267 TGGGGGGGTTTGGGTTTGTTTGG + Intergenic
1109132332 13:58602801-58602823 GGGGTGGAGTAGGAGTTGATGGG + Intergenic
1109778365 13:67074215-67074237 TGGGGGTTTTTGTAGGTGATTGG + Intronic
1111231344 13:85347826-85347848 ACGGGTGATTTGGAATTGATTGG - Intergenic
1114362656 14:21992056-21992078 AGGGTGGATTTGGAGCTGAGAGG + Intergenic
1116466907 14:45244547-45244569 TGGGGGGAGTTGGATTTAACTGG - Intronic
1116719450 14:48475996-48476018 TGTGGGGAATTGGAGATGAAAGG + Intergenic
1120140496 14:80925461-80925483 AGGATGGATTTGGAGTTGAAAGG - Intronic
1120150065 14:81022842-81022864 TGGGGCGTTTGGGAGGTGATTGG + Intronic
1121129068 14:91428728-91428750 TTGGGGGATTTGGATGGGATAGG + Intergenic
1121806288 14:96827218-96827240 GGGGTGAATTTGGAGTTGAGAGG - Intronic
1122902363 14:104787132-104787154 TGAGGGGGTTGGGAGTTCATGGG - Intronic
1124200438 15:27674523-27674545 TGGGGCCACTTGGAGGTGATGGG + Intergenic
1124468136 15:29958775-29958797 TGTAGGGATGTGGAGTTGCTGGG - Intronic
1126088778 15:45033324-45033346 TAGGGGGATTTAAAGTAGATGGG - Intronic
1126797926 15:52275396-52275418 TGGTGGGATTTGAAGGAGATGGG - Intronic
1127945961 15:63753553-63753575 TGGTTGGATTTGTAGATGATTGG - Intronic
1128773764 15:70303138-70303160 TGGGTGGATATGAAGTGGATGGG + Intergenic
1128773802 15:70303391-70303413 TGGGTGGATATGAAGTGGATGGG + Intergenic
1128773842 15:70303643-70303665 TGGGTGGATATGAAGTGGATGGG + Intergenic
1129160712 15:73746195-73746217 TGGGGGGCTGTGGAGTTGGAGGG + Intronic
1129169256 15:73797838-73797860 TGGGAGGATCTGGAGAGGATGGG + Intergenic
1130533232 15:84763827-84763849 TGTGGGTATATGTAGTTGATGGG + Intronic
1130657252 15:85800330-85800352 TGGGGGGAGTGGGATTTGATTGG + Intergenic
1131416640 15:92265580-92265602 TGGAGGGTTTTGGAGTGGATAGG + Intergenic
1133823797 16:9259713-9259735 TGGGGCGATGGGGAGTCGATGGG + Intergenic
1137332586 16:47514015-47514037 TGGGGGGCTTTGGAGAATATAGG - Intronic
1138061432 16:53895107-53895129 TGTGGGGAATTGGAGTGGGTGGG - Intronic
1138137379 16:54535263-54535285 TGGGTGGAGTTGGAGTTCATGGG + Intergenic
1139780799 16:69349781-69349803 TGCTGGGGTTTGGAGTTGATTGG + Intronic
1140220800 16:73042554-73042576 TGGGGTGATTTGGGGTGGTTAGG - Intronic
1141659781 16:85435621-85435643 AGGGGGGATCTGGGCTTGATGGG + Intergenic
1142328692 16:89435914-89435936 TGCGGTGATTTAGAGGTGATGGG - Intronic
1143210657 17:5184880-5184902 TGGGTGGATCTGGAGTTGAGAGG + Intronic
1145246480 17:21273093-21273115 TGGAGAAATGTGGAGTTGATAGG - Intergenic
1146181670 17:30702443-30702465 TGGGGGGTTTTAGAGAGGATAGG + Intergenic
1146552034 17:33788899-33788921 TGGGGGGGTTGGGAATTGAGGGG + Intronic
1146757607 17:35447608-35447630 TGGGGGGCTTGGGAGTGGATGGG - Intronic
1147556626 17:41483575-41483597 GGGGCAGATTTGGATTTGATGGG - Intergenic
1147842935 17:43385450-43385472 AGGGGGGATTTGGAGGGGAGAGG - Intergenic
1148088119 17:45006769-45006791 TGGGGGGGTTTGGAGGGGGTTGG - Intergenic
1151144586 17:72029281-72029303 TGGGAGGGGTTGGAGTTGAAGGG - Intergenic
1152543086 17:80986875-80986897 AGGGTGGATTTGGAGCTGAGGGG - Intergenic
1152828172 17:82480461-82480483 TGGGGGGCTTTGCAGATGTTTGG + Intronic
1152865580 17:82720849-82720871 TGGGGAGATTTGCTGATGATCGG + Intronic
1154177427 18:12094392-12094414 TGGGGGGCGTTGGATGTGATGGG + Intronic
1154177482 18:12094538-12094560 TGGGGGGCGTTGGATGTGATGGG + Intronic
1155377919 18:25181629-25181651 TAGGGGGATATTGACTTGATGGG - Intronic
1155841504 18:30650193-30650215 TGGGGAGATTTGTAGTTGACAGG + Intergenic
1160866617 19:1259169-1259191 TGGGGGGATCTGGCCTTGGTTGG + Intergenic
1163588414 19:18176595-18176617 TGATGGGATGTGGAGATGATAGG + Intronic
1164705019 19:30313577-30313599 TGGGAGGCTTTGGAGGTCATGGG - Intronic
1164847331 19:31444840-31444862 TGGGTGAATTTGGAGCTGAGAGG - Intergenic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1165956260 19:39503722-39503744 TGAGGGGATTTGGGATTGGTGGG - Intronic
1166759146 19:45213563-45213585 AAGGGGGATTTGGAGATGGTTGG - Intronic
1168067921 19:53929850-53929872 TGGTGGGATTTAGAGTGAATGGG + Intronic
925866664 2:8234128-8234150 AAGGTGGATTTGGAGTTGAAGGG - Intergenic
927241487 2:20923296-20923318 TGGGGGGAGTTCGAGGTGCTTGG + Intergenic
928228386 2:29475317-29475339 TGAGGGGATGTGGAGTTGGGAGG - Intronic
930153351 2:48080085-48080107 TGGGGTGAATTGGTGTTGGTCGG + Intergenic
930708853 2:54530990-54531012 TGGGGGGAGTTGGTGTAGGTAGG + Intronic
931663600 2:64593581-64593603 TGGTGGGATATGGACTGGATAGG - Intergenic
932765998 2:74470502-74470524 TGGTGGGATTTGGAGGAAATTGG + Intergenic
935435803 2:103030675-103030697 TGAGGGTATGTGAAGTTGATTGG + Intergenic
936053183 2:109240966-109240988 TGGGGAGATGTGGACTTGTTTGG - Intronic
943705231 2:191027081-191027103 TGCTGGGTTTTGGACTTGATGGG + Intergenic
945593217 2:211760211-211760233 TGAGGGGATTTGTAGATGACTGG + Intronic
946158671 2:217822916-217822938 GGGTGGGATTTGGAGGTGGTAGG - Intronic
948470461 2:238174242-238174264 TGAGGGGATATGGAGGAGATGGG + Intronic
1170269319 20:14506609-14506631 TGGAAGGTTTTGGAGTTGTTTGG - Intronic
1171493037 20:25535263-25535285 TCGGGGGTTGTGGAGTTGTTGGG + Intronic
1172047739 20:32092681-32092703 TGGGGAGAGTTGAAGTTGAGAGG - Intronic
1172223275 20:33287995-33288017 TGGGTGGATTTGCAGCTGAGAGG + Intronic
1173213862 20:41060837-41060859 TGGGGGGATTTGTATTTTTTTGG + Intronic
1174382553 20:50165926-50165948 TGGGGGGAAATGGAATTGCTGGG - Intergenic
1175726500 20:61322241-61322263 TGTGGGGAGTTGGAGGGGATGGG - Intronic
1176258892 20:64168683-64168705 TGGGGTTGCTTGGAGTTGATTGG + Intronic
1176756877 21:10732042-10732064 TGGAGGGGATTGGAGTTGACTGG - Intergenic
1179245244 21:39627545-39627567 TGGGGGGAAATGGAGGTGAAAGG - Intronic
1180539058 22:16424198-16424220 TGAGGGGAAATGGAGTTTATTGG + Intergenic
1182557483 22:31137045-31137067 GGGGTGGATGTGGTGTTGATGGG + Intronic
1184402859 22:44283993-44284015 CTGGGGGATGTGGAGGTGATGGG - Intronic
1203305672 22_KI270736v1_random:107402-107424 TGGAGTGGATTGGAGTTGATTGG + Intergenic
950028125 3:9834578-9834600 TGGGGGGATATGGAGGGAATGGG - Intronic
950798640 3:15531629-15531651 TGGGAGGATTTGGACATGAAGGG - Intergenic
951256637 3:20457739-20457761 AGGTGGAATATGGAGTTGATGGG - Intergenic
952210593 3:31225756-31225778 TGGATGGATTTGGAGCTGAAAGG - Intergenic
952384636 3:32831157-32831179 TGGGGGATTTTGGAGATGAAAGG + Intronic
952895172 3:38073887-38073909 TAGGGGGATTCTGAGGTGATCGG + Intronic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
952974584 3:38682906-38682928 TGGGTGGATTGGGAGGTGAGTGG + Intergenic
953145432 3:40270552-40270574 TGTTGGGATTTGGATTTGCTTGG - Intergenic
953737742 3:45510736-45510758 CGGAGGAATTTGGACTTGATTGG + Intronic
953962443 3:47277131-47277153 GGGGGTGGTTTGGATTTGATGGG + Intronic
957237971 3:77619689-77619711 TGGGGGGGCTTGGAGTTGCATGG - Intronic
957768557 3:84658418-84658440 TGGCTGGATTTGGAGTGGCTGGG - Intergenic
957991720 3:87635026-87635048 TGGGGGGAGTTGGAGGTGATTGG - Intergenic
959006811 3:101028850-101028872 TGGGGGGATGTGGAATTTCTAGG - Intergenic
960228871 3:115200829-115200851 TAGGGGGATTATGAGTTCATAGG + Intergenic
961360546 3:126364639-126364661 TAAGGGGAAATGGAGTTGATAGG + Intergenic
962456164 3:135567456-135567478 TGTGGGGATTTGGAGCTGCTTGG + Intergenic
965249333 3:166322447-166322469 TGTGGGGCTTTGCTGTTGATTGG + Intergenic
966504522 3:180684680-180684702 TGGGTGAATTTGGAGCTGAGAGG - Intronic
966640865 3:182188055-182188077 TGGGGCTTTTTGGAGGTGATTGG - Intergenic
966751250 3:183324193-183324215 TGAGGGGATCTGGAGGTGACAGG + Intronic
968107682 3:196014041-196014063 GGGGGGGTGTTGGAGTGGATGGG + Intergenic
968785772 4:2621297-2621319 AGGGTGGATTTGGAGTTGAGAGG + Intronic
969539448 4:7777783-7777805 TGTGGGGATTTACAGGTGATGGG - Intronic
970016785 4:11520921-11520943 TGTGGGTATTTGGAGCTGATTGG - Intergenic
970895373 4:21096969-21096991 TTGAGGGATTTGGAGTTTAATGG - Intronic
973102539 4:46291133-46291155 TGGAGGAGTTTGGAGATGATTGG + Intronic
973105351 4:46329187-46329209 AGGGTGGATTTGGAGTTGAGAGG - Intronic
973212148 4:47627941-47627963 TGGGGGCCTTTTGAGTTGAAAGG - Intronic
973638196 4:52879094-52879116 TGGGGTGGCTAGGAGTTGATGGG - Intronic
976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG + Intronic
976964844 4:91024155-91024177 TGGGGGGTTTAAGAGCTGATTGG - Intronic
977869370 4:102071770-102071792 TGGGGGGATTGTGTGCTGATGGG + Intronic
982706022 4:158710918-158710940 AGGATGGGTTTGGAGTTGATAGG - Intronic
984824585 4:183913279-183913301 TGGGCGGATTCAGAGTTTATGGG + Intronic
984930012 4:184838739-184838761 TGGGGGGATTTGGAAGTGACTGG + Intergenic
987282083 5:16422493-16422515 TGGGGGGCTTCCGAGGTGATTGG - Intergenic
987755302 5:22093318-22093340 TGGTGGGGTTTGGAGCTCATGGG + Intronic
989290792 5:39762579-39762601 TGGGGTGTTTGGGAGGTGATTGG - Intergenic
991069536 5:62461233-62461255 TGGGGGGATGGGGGGTTGAGAGG + Intronic
991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG + Intronic
996225156 5:120983802-120983824 TGTGGGGATTAGGGGTTGATGGG + Intergenic
998770092 5:145533254-145533276 TGGGGAGATCTGGGGCTGATGGG + Intronic
1002392818 5:178929054-178929076 TGGGTGGATCTGGAGTAGCTGGG + Intronic
1002876309 6:1213673-1213695 TGGGGGAATTGGGAATTCATTGG + Intergenic
1003404901 6:5820372-5820394 TGGGAGAAGTTGGAATTGATTGG - Intergenic
1006563033 6:34930258-34930280 TGGGGGGACTTAGAGGTGGTAGG + Intronic
1007189758 6:40003522-40003544 TGGTGGTATTTGGAGGTAATTGG - Intergenic
1008872808 6:56291606-56291628 AGGGTGGGTTTGGAGTTGAGAGG + Intronic
1009618916 6:66046313-66046335 TGTTGGGTTTTGGATTTGATTGG + Intergenic
1010386256 6:75284362-75284384 TGGTGGGAGTTGGCGTTGCTCGG - Intronic
1015731367 6:136351730-136351752 TGGGTGAATTTGGAGCTGAGAGG - Intronic
1017638932 6:156471633-156471655 TGAGGGGATGTGGAGTTGGAAGG - Intergenic
1018056758 6:160058817-160058839 TAGTGGGATTTGGAGTTGCTAGG + Intronic
1020480087 7:8648292-8648314 TGGGGGGATTGGGTGTAGGTGGG - Intronic
1022996494 7:35761021-35761043 TGGTGGGAGTTGCTGTTGATTGG - Intergenic
1023347419 7:39285786-39285808 TGGGGGAACATGGAGTTGCTGGG - Intronic
1023930446 7:44702174-44702196 TGGGGGCATTTGCAGGTGAGAGG - Intronic
1024742159 7:52365874-52365896 TTCAGGGATTTGGAGATGATTGG + Intergenic
1024798600 7:53049519-53049541 TAAGGGGATATGGACTTGATTGG + Intergenic
1024798773 7:53051369-53051391 TAAGGGGATATGGACTTGATTGG - Intergenic
1026275493 7:68872280-68872302 TGGGGGGATTTGGGGGTTGTAGG - Intergenic
1027917925 7:84350001-84350023 TGGGGGGATTTGGGGCAGAGAGG - Intronic
1030282724 7:107793563-107793585 AGGGGGGATGTGAAGTTAATGGG + Intronic
1032549869 7:132774819-132774841 TTGGGGTATTTGGGGCTGATGGG - Intergenic
1032694528 7:134322698-134322720 AGGGTGGATTTGGAGTGGAGAGG + Intergenic
1032852987 7:135811054-135811076 CTGGGGGATTTGGATTAGATCGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1035100125 7:156389493-156389515 CGGGCGGCTTTGGAGTTGGTCGG - Intergenic
1036526217 8:9537288-9537310 TGGGGGGATGTGGAGAGGGTTGG - Intergenic
1036682915 8:10888747-10888769 GCTGGGGATTTGGGGTTGATTGG - Intergenic
1037128603 8:15380925-15380947 TGGTGGCATGTGGTGTTGATTGG + Intergenic
1038720505 8:30031200-30031222 TGGTTGGATTTGGATTTGGTTGG - Intergenic
1041280724 8:56209706-56209728 GGGAGGGATGTGGAGTTGCTTGG - Intronic
1045584147 8:103512317-103512339 AGGGTGGATTTGGAGCTGAGAGG + Intronic
1047092389 8:121588477-121588499 TGGGTGAATTTGGAGCTGATAGG - Intergenic
1049272903 8:141705521-141705543 TGAGGAGATGTGGAGATGATGGG + Intergenic
1049688569 8:143949093-143949115 TGGGGTGAGTTGGACTTGTTAGG - Intronic
1052456816 9:28710120-28710142 TGGGGCCATTGGGAGCTGATTGG + Intergenic
1053006053 9:34605381-34605403 TGAGGGTTTTTGGAGCTGATAGG - Intergenic
1055898409 9:81206843-81206865 TGGGGAGATTGGGAGTTAATGGG + Intergenic
1059260544 9:112971977-112971999 TCTGGAGATTTGGGGTTGATGGG + Intergenic
1060056569 9:120419026-120419048 TGGGGGCTTTGGGAGATGATAGG + Intronic
1060442865 9:123657404-123657426 TGGGGGGAGTTGGAGTGGGGTGG + Intronic
1060785167 9:126446078-126446100 TGGGGGAATTTGGAGGAGAGAGG + Intronic
1060795000 9:126507364-126507386 TGGGGGGAGTCGGAGGTGAAAGG - Intergenic
1060798445 9:126528111-126528133 TGGGGAGAATTGGAGTTCAGAGG - Intergenic
1061005685 9:127927538-127927560 TGGGCGGATTTGGGGTTGTAGGG - Intronic
1062291799 9:135798653-135798675 TGGGGGGTGTTGAAGTTCATGGG - Intergenic
1185615541 X:1419578-1419600 TGGGGGGACTTGGAGAAGCTCGG - Intronic
1185751730 X:2615820-2615842 TGGGGGGATTAGGTGGTGCTGGG - Intergenic
1186368150 X:8917710-8917732 TGGGGCGTTTAGGAGATGATTGG + Intergenic
1186683085 X:11896392-11896414 TGGGGTCATTAGGAGGTGATTGG + Intergenic
1187102792 X:16212388-16212410 AGGGTGAATTTGGAGTTGAGAGG - Intergenic
1187291756 X:17961412-17961434 TGGTGGAATGTGGAGGTGATGGG + Intergenic
1187512259 X:19931255-19931277 TGGGAAGATTTGGAGAGGATTGG - Intronic
1188134580 X:26479491-26479513 TTGGGGGATTTGGAGTTAAGGGG + Intergenic
1189137555 X:38564391-38564413 TGGGGGACATTTGAGTTGATTGG + Intronic
1189380961 X:40501787-40501809 TGAGGTGATTGGGAGGTGATTGG - Intergenic
1190264956 X:48822796-48822818 TGAGTGGATTTGGGGGTGATGGG + Intronic
1193133002 X:77937839-77937861 TGAGGGATTTTGGAGGTGATGGG + Intronic
1193553332 X:82925783-82925805 TGGGATCTTTTGGAGTTGATGGG - Intergenic
1193589041 X:83364821-83364843 TGTGGGCATTTGGAGATGATTGG + Intergenic
1195435246 X:104836272-104836294 TGGGGGGCTGTGGAGGAGATGGG + Intronic
1197328939 X:125129571-125129593 TGGGGGGAAGTGGAGATAATAGG - Intergenic
1197632888 X:128882419-128882441 TGGTGGGATTTGTAGGAGATTGG - Intergenic
1198603904 X:138315153-138315175 TGGTGGGGTTGGGAGTTGAATGG + Intergenic
1199751799 X:150826603-150826625 TTGGGGGATTGGGAAGTGATAGG + Intronic
1201107239 Y:10772325-10772347 TGGGGTGGATTGGGGTTGATTGG - Intergenic
1201112195 Y:10807679-10807701 TGGAGTGGTTTGGAGTTGAATGG - Intergenic
1201112278 Y:10808259-10808281 TGGAGGGAAGTGGAGTTGATTGG - Intergenic
1201112370 Y:10808957-10808979 TGGGGTGGATTGGAGTTGAATGG - Intergenic
1201112485 Y:10810495-10810517 TGGGGTGGATTGGAGTTGAATGG - Intergenic
1201112540 Y:10810850-10810872 TGGAGTGGTTTGGAGTTGAATGG - Intergenic
1201115047 Y:10829037-10829059 TGGAGGGGTTTGGAGTGGAGTGG - Intergenic
1201120537 Y:10869394-10869416 TGGAGGGGATTGGAGTTGAGTGG - Intergenic