ID: 991454624

View in Genome Browser
Species Human (GRCh38)
Location 5:66789214-66789236
Sequence CATACACACATGATTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 673}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991454623_991454624 19 Left 991454623 5:66789172-66789194 CCTTTCTCTTTGTCTATGTGTGT 0: 1
1: 3
2: 29
3: 222
4: 1937
Right 991454624 5:66789214-66789236 CATACACACATGATTTTTTGAGG 0: 1
1: 0
2: 1
3: 40
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991454624 Original CRISPR CATACACACATGATTTTTTG AGG Intronic
904830323 1:33302237-33302259 CCAACACATATGTTTTTTTGGGG + Intergenic
904881776 1:33704538-33704560 CTTAATCACATGATGTTTTGGGG + Intronic
904939639 1:34156580-34156602 GATGGACACATAATTTTTTGAGG + Intronic
905384594 1:37593090-37593112 CATACATACTTGAGTTTTTTGGG + Intronic
906458024 1:46014498-46014520 CATGAACTCATCATTTTTTGTGG + Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
907678324 1:56539415-56539437 CATACACACATGGATTTATTTGG + Intronic
908121564 1:60990870-60990892 CAAACACAAATGATACTTTGTGG + Intronic
908283936 1:62572776-62572798 CTTCAACATATGATTTTTTGGGG + Intronic
909189233 1:72531326-72531348 CATGAACTCATCATTTTTTGTGG + Intergenic
909302531 1:74031430-74031452 CATGAACTCATCATTTTTTGTGG - Intronic
909404374 1:75270671-75270693 CATATATACATGATTTTCAGTGG + Intronic
909412422 1:75370654-75370676 CATACACTTGTGAGTTTTTGTGG - Intronic
909739811 1:79014182-79014204 CATGAACTCATCATTTTTTGTGG + Intergenic
910164950 1:84317083-84317105 CATTCTCACAGGTTTTTTTGTGG + Intronic
910198372 1:84670070-84670092 CATACTTATATCATTTTTTGTGG - Intronic
910644307 1:89496791-89496813 CATGAACTCATCATTTTTTGTGG - Intergenic
910754073 1:90667797-90667819 CATACACACATATTTATTTTTGG - Intergenic
910873346 1:91854611-91854633 CACACACTTATCATTTTTTGTGG - Intronic
910910852 1:92232432-92232454 CATGAACTCATCATTTTTTGTGG + Intronic
911245178 1:95509068-95509090 CTACCACACATGATTTTTTTGGG + Intergenic
911543913 1:99192532-99192554 CATAATCACATTCTTTTTTGTGG - Intergenic
911685981 1:100778290-100778312 CATGAACTCATCATTTTTTGTGG - Intergenic
911860583 1:102942707-102942729 AATACACAAATGAGCTTTTGAGG - Intronic
911945957 1:104108963-104108985 CATACATACAGGTTTTTATGTGG + Intergenic
911966320 1:104376347-104376369 CATGAACTCATCATTTTTTGTGG - Intergenic
912139044 1:106698844-106698866 GATTAACACATGAATTTTTGGGG - Intergenic
914845166 1:151279810-151279832 CATATACACATAATATTTTGGGG - Intergenic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
915869583 1:159543906-159543928 CATGAACACATCATTTTTTATGG - Intergenic
915919015 1:159960338-159960360 CATAAACTCATCATTTTTTATGG + Intergenic
917961242 1:180146841-180146863 CATATACACATGTATTTTAGTGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918695429 1:187540951-187540973 CATGCACTCATCATTTTTTATGG + Intergenic
918703455 1:187633852-187633874 CATGCACTCATCATTTTTTATGG - Intergenic
918838981 1:189509800-189509822 CATTTACACATGACTTTTAGTGG - Intergenic
918945347 1:191057610-191057632 CATGAACTCATGCTTTTTTGTGG + Intergenic
918975478 1:191479436-191479458 CACACATACATCATATTTTGTGG - Intergenic
919142826 1:193594615-193594637 CATACATATATGATTTTGGGGGG - Intergenic
920534512 1:206728951-206728973 TGTAAACACTTGATTTTTTGGGG + Intronic
920828248 1:209442643-209442665 CATCAACATATGATTTTTGGGGG - Intergenic
921095682 1:211885379-211885401 CACACACAGATGTTGTTTTGGGG + Intergenic
921558672 1:216629968-216629990 CATATACACAGTAATTTTTGAGG + Intronic
921585361 1:216940248-216940270 CATACACTAATGATGTTTTAGGG + Intronic
921672091 1:217936801-217936823 CACATACATATAATTTTTTGTGG - Intergenic
922728020 1:227934150-227934172 CATTCACACATGTGTTTGTGTGG + Intronic
923741384 1:236658105-236658127 TAAATATACATGATTTTTTGAGG - Intergenic
923864865 1:237928755-237928777 AATACACATATTATTTTTTTGGG - Intergenic
924431292 1:243999139-243999161 CAGACACACCACATTTTTTGTGG - Intergenic
924479030 1:244410635-244410657 AAAACACACAACATTTTTTGTGG + Intronic
924873401 1:248073294-248073316 CATAAACTCATCATTTTTTATGG - Intronic
1063263183 10:4413713-4413735 CATGAACTCATGATTTTTTATGG + Intergenic
1064737627 10:18399018-18399040 CACCCACACATAATTTTGTGCGG - Intronic
1065655642 10:27946499-27946521 CTTAAACACATCTTTTTTTGTGG + Intronic
1067326850 10:45276888-45276910 CATAAACTCATAATTTTTTATGG - Intergenic
1067845868 10:49720714-49720736 CATGAACTCATCATTTTTTGTGG - Intergenic
1068201832 10:53792669-53792691 CATGAACTCATCATTTTTTGTGG + Intergenic
1068576610 10:58690824-58690846 GATTCACACATGCTTTTTTAGGG - Intronic
1069094247 10:64239294-64239316 CTTATACACTGGATTTTTTGTGG + Intergenic
1069203708 10:65655727-65655749 CATAAACTCATCATTTTTTATGG - Intergenic
1069205933 10:65685783-65685805 CTTACTCACATGATTTATGGAGG - Intergenic
1069411607 10:68159953-68159975 CTCACACACATCATTTTTTGTGG + Intronic
1070202662 10:74222679-74222701 CATAAACTCATCATTTTTTATGG - Intronic
1070225393 10:74498875-74498897 CATGAACACATCATTTTTTATGG - Intronic
1070561462 10:77570405-77570427 CATGAACTCATGATTTTTTATGG - Intronic
1070741564 10:78906754-78906776 CATACACACCTGTTTTTTCTTGG - Intergenic
1071048599 10:81416938-81416960 CATAAACTCATCATTTTTTATGG + Intergenic
1071944791 10:90632113-90632135 CATATATACATTTTTTTTTGTGG - Intergenic
1071991994 10:91108539-91108561 CATAAACTCATCATTTTTTATGG + Intergenic
1073017380 10:100412158-100412180 CATGAACTCATGATTTTTTATGG - Intergenic
1073668068 10:105555889-105555911 CATGAACACATGATTTTTTATGG - Intergenic
1073923750 10:108489075-108489097 CATAAACTCATCATTTTTTATGG - Intergenic
1074028145 10:109658155-109658177 CATGAACTCATCATTTTTTGTGG - Intergenic
1074030390 10:109681884-109681906 CATGAACTCATCATTTTTTGTGG + Intergenic
1074642730 10:115406015-115406037 CATAAACTCATCATTTTTTACGG + Intronic
1075188522 10:120284876-120284898 CATACAAGGATGATTTTTAGTGG - Intergenic
1075959298 10:126554067-126554089 CACACACACAAGAATATTTGTGG + Intronic
1076371078 10:129954066-129954088 CACACACAAATGATTTTTAATGG - Intronic
1077387655 11:2278467-2278489 TAGAAACACTTGATTTTTTGGGG - Intergenic
1077638826 11:3862891-3862913 CACACACACATATTTTTTTGAGG + Intronic
1078370175 11:10737736-10737758 CACACACACACGTTTTTTTGTGG + Intergenic
1079334159 11:19556303-19556325 CTTACACACATAATTTTTAATGG - Intronic
1079678250 11:23260286-23260308 CATGAACTCATCATTTTTTGTGG + Intergenic
1079753080 11:24222914-24222936 CATAAACTCATCATTTTTTATGG - Intergenic
1080078419 11:28181580-28181602 CATAAACTCATCATTTTTTAAGG + Intronic
1080177236 11:29379665-29379687 CATGCACTCATCATTTTTTATGG - Intergenic
1080235074 11:30058882-30058904 CATGAACTCATCATTTTTTGTGG - Intergenic
1080364035 11:31549805-31549827 CATGAACTCATCATTTTTTGTGG - Intronic
1081102296 11:39019675-39019697 TATACACAAATGATAATTTGTGG + Intergenic
1081442471 11:43095334-43095356 CATAAACTCATCATTTTTTATGG + Intergenic
1082164613 11:48930823-48930845 CATAAACTCATCATTTTTTATGG - Intergenic
1082228012 11:49730974-49730996 CATGAACTCATCATTTTTTGGGG - Intergenic
1082311117 11:50649756-50649778 CATGAACTCATGATTTTTTATGG - Intergenic
1082574911 11:54790352-54790374 CATGAACACATCATTTTTTATGG - Intergenic
1082948965 11:58789845-58789867 CATATATACATATTTTTTTGAGG - Intergenic
1083055706 11:59817265-59817287 CACACACACACAGTTTTTTGAGG - Intergenic
1083269438 11:61564220-61564242 CATGCACACATGAATTCTGGGGG - Intronic
1083362874 11:62123648-62123670 TATACATACATGTTTTTATGAGG + Intergenic
1083520429 11:63305785-63305807 CTTAAACACATCATTTTTTGGGG + Intronic
1084488721 11:69466009-69466031 CCCACCCACATTATTTTTTGAGG - Intergenic
1085420099 11:76349932-76349954 CTTAGGCACATTATTTTTTGTGG - Intergenic
1085868531 11:80323427-80323449 AATACATACATGAGTTTCTGGGG - Intergenic
1085977130 11:81670686-81670708 CATAGATACATGGTGTTTTGTGG - Intergenic
1086065615 11:82740788-82740810 CATTCACACCTTATTTTTTAAGG - Intergenic
1086310206 11:85527519-85527541 CATGCACTCATTATTTTTTATGG + Intronic
1086417517 11:86603763-86603785 CATGAACACATCATTTTTTATGG - Intronic
1086630524 11:89013314-89013336 CATAAAGACAAGATTATTTGTGG - Intronic
1086762677 11:90652697-90652719 CATAAAAATATAATTTTTTGTGG - Intergenic
1086841019 11:91684325-91684347 CATGAACTCATCATTTTTTGTGG - Intergenic
1087179263 11:95125766-95125788 CATGAACTCATCATTTTTTGTGG + Intronic
1087878408 11:103386823-103386845 CATGAACTCATCATTTTTTGTGG + Intronic
1087979382 11:104592308-104592330 TATACATACGTGATCTTTTGAGG + Intergenic
1088767532 11:112998136-112998158 CATATGCACATAATTTTTAGTGG + Intronic
1089907335 11:122054372-122054394 CATAAACTCATCATTTTTTATGG - Intergenic
1090115587 11:123968731-123968753 CATGAACACATCATTTTTTATGG - Intergenic
1090523863 11:127507948-127507970 CATATACACATAATTTTGTAAGG - Intergenic
1090848432 11:130549470-130549492 CCTAGACTCATGATCTTTTGGGG - Intergenic
1091123530 11:133076661-133076683 CATTCACACATGATTCTATGCGG - Intronic
1091804118 12:3343702-3343724 CATAAACACATGGCGTTTTGAGG + Intergenic
1091861403 12:3788163-3788185 CATAAACACATCCTTTTTTATGG - Intergenic
1092492021 12:8954059-8954081 CATGTCCATATGATTTTTTGAGG + Intronic
1093204029 12:16225050-16225072 CATGAACCCATGATTTTTTATGG + Intronic
1093394496 12:18664825-18664847 CATGAACTCATCATTTTTTGTGG - Intergenic
1094450844 12:30581713-30581735 CTTCAACACATGAATTTTTGGGG - Intergenic
1094484177 12:30911208-30911230 CACACACACACGATTTCTTTTGG + Intergenic
1094730115 12:33164757-33164779 CATAGTCCCATGATTTTTGGAGG - Intergenic
1094739287 12:33270165-33270187 CATGCACTCATCATTTTTTATGG + Intergenic
1095109770 12:38280172-38280194 CACACACACATGAGTCTTTTAGG + Intergenic
1097162012 12:57053335-57053357 CATAAACTCATCATTTTTTATGG + Intergenic
1097253302 12:57652154-57652176 CATAAACTCATCATTTTTTATGG - Intergenic
1097344076 12:58471727-58471749 CATAAACTCATCATTTTTTATGG + Intergenic
1097537877 12:60896775-60896797 CATAAACTCATCATTTTTTGTGG + Intergenic
1097576659 12:61402143-61402165 CATAAACTCATCATTTTTTATGG - Intergenic
1097617784 12:61904320-61904342 CTTAAATACATGAGTTTTTGGGG - Intronic
1097627561 12:62019488-62019510 CATAAACTCATCATTTTTTATGG - Intronic
1097685354 12:62685781-62685803 CATATACTTATCATTTTTTGTGG - Intronic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1098498325 12:71162801-71162823 CATACACAGATGGTGTCTTGGGG + Intronic
1098877780 12:75884471-75884493 CATACACACATAATGCTATGTGG - Intergenic
1099084656 12:78230621-78230643 CAAATACACCTGATTATTTGGGG + Intergenic
1099312733 12:81048190-81048212 CATAAACTCATCATTTTTTATGG + Intronic
1100545482 12:95597989-95598011 CATAAACTCATCATTTTTTATGG + Intergenic
1101969503 12:109303128-109303150 CATGCACACATGTGTTTTTTAGG + Intronic
1102449213 12:113028110-113028132 AATACACATATTTTTTTTTGTGG + Intergenic
1103640138 12:122344330-122344352 CATTTACACATGATTTTCTGGGG + Intronic
1104519867 12:129463797-129463819 CATAAACTCATCATTTTTTATGG + Intronic
1106385217 13:29278001-29278023 CATTCAAACATGATTTATTGGGG - Intronic
1106931253 13:34668187-34668209 CATACACACTTGGTTGTTTGGGG + Intergenic
1108083542 13:46761669-46761691 CAGACACAGATTATTTTTTCAGG - Intergenic
1108109356 13:47051418-47051440 CATTAACACAGGAATTTTTGGGG + Intergenic
1108191341 13:47942365-47942387 AAAACACATATGTTTTTTTGTGG + Intronic
1108417153 13:50209356-50209378 CATATTCAAATGATTTTTTTAGG - Intronic
1108982899 13:56541538-56541560 CACACACACATTTTTTTTTCAGG - Intergenic
1109689944 13:65873221-65873243 CATACCCACATTCTTTTTTATGG + Intergenic
1109798971 13:67349657-67349679 CATGAACACATCCTTTTTTGTGG + Intergenic
1109812066 13:67526143-67526165 CATGAACTCATCATTTTTTGTGG + Intergenic
1109854919 13:68114427-68114449 CATAAACTTATTATTTTTTGTGG - Intergenic
1110504637 13:76271378-76271400 CATGAACTCATGCTTTTTTGTGG + Intergenic
1110701030 13:78549248-78549270 TATACACACACAATTTTGTGTGG - Intergenic
1110706584 13:78606027-78606049 CCTACACACGTGTTTTTTGGTGG - Intergenic
1110822657 13:79934598-79934620 CATAAACACATTCTTTTTTATGG - Intergenic
1110998194 13:82140421-82140443 CATGAACTCATCATTTTTTGTGG - Intergenic
1111076613 13:83244478-83244500 CATGAACTCATGATTTTTTATGG + Intergenic
1111274390 13:85928614-85928636 CATACACACATTATTTATATTGG + Intergenic
1112282045 13:98071542-98071564 CAGACACAAATGATTTTTCCTGG - Intergenic
1112838596 13:103547677-103547699 CATAAACTCATCATTTTTTATGG - Intergenic
1112866239 13:103903162-103903184 CATGCATACATGGTTTTGTGTGG + Intergenic
1113071754 13:106428592-106428614 AAAACACACATGCCTTTTTGTGG + Intergenic
1113380777 13:109803773-109803795 CATTCCTACATGATTTATTGAGG - Intergenic
1114011185 14:18370380-18370402 CATGAACTCATGATTTTTTATGG - Intergenic
1114279648 14:21180230-21180252 CATATACTTATCATTTTTTGTGG + Intergenic
1114388469 14:22280242-22280264 CATGCACACATTCTTCTTTGAGG - Intergenic
1115171378 14:30511584-30511606 CATAGACTGATGATTTTCTGGGG - Intergenic
1115180339 14:30618492-30618514 CACACACACATACTTTGTTGGGG + Exonic
1115318135 14:32048607-32048629 CATACACCTATGATTTTATTTGG - Intergenic
1115409446 14:33056974-33056996 CATTCACAAAGGATTTTTTAAGG - Intronic
1115716253 14:36107299-36107321 GATACACATTTAATTTTTTGCGG - Intergenic
1115881118 14:37920494-37920516 CATGCACACGTGGTTTATTGCGG - Intronic
1116094822 14:40353741-40353763 CATGAACTCATCATTTTTTGTGG - Intergenic
1116377228 14:44218290-44218312 CATATACACATGTGTCTTTGTGG - Intergenic
1116706976 14:48315150-48315172 CATGAACTCATGATTTTTTATGG - Intergenic
1116714716 14:48412690-48412712 CATGAACTCATGATTTTTTATGG + Intergenic
1116767881 14:49094127-49094149 CATGAACTCATGATTTTTTATGG - Intergenic
1116785765 14:49287111-49287133 CAAACTCAGATGATTGTTTGGGG - Intergenic
1117944957 14:61009704-61009726 CATGCACTCATCATTTTTTATGG + Intronic
1118133831 14:62999531-62999553 CATAAACTCATCATTTTTTATGG - Intronic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1118989360 14:70783931-70783953 CATTCACAGATGATTGTTTATGG - Intronic
1119129509 14:72158431-72158453 CTTCCACATATAATTTTTTGAGG + Intronic
1120043534 14:79780171-79780193 AATTCACAGATGCTTTTTTGAGG + Intronic
1120606308 14:86582894-86582916 CATAAACTCATCATTTTTTATGG - Intergenic
1120735072 14:88043353-88043375 CATGAACTCATGATTTTTTACGG + Intergenic
1121129342 14:91431186-91431208 CATAAACTCATCATTTTTTATGG + Intergenic
1121720507 14:96105506-96105528 CCTCCAAACATGATATTTTGAGG - Intergenic
1122824969 14:104365571-104365593 CATCAACACATTATTTTTTGTGG - Intergenic
1123217013 14:106819450-106819472 CATGAACTCATCATTTTTTGTGG - Intergenic
1202847697 14_GL000009v2_random:195652-195674 CATAAACTCATCATTTTTTATGG - Intergenic
1202917168 14_GL000194v1_random:186195-186217 CATAAACTCATCATTTTTTATGG - Intergenic
1123572521 15:21628659-21628681 CATGAACTCATCATTTTTTGTGG + Intergenic
1123583204 15:21735138-21735160 CATGCACAAATGAGTTTTTTTGG + Intergenic
1123609140 15:22071246-22071268 CATGAACTCATCATTTTTTGTGG + Intergenic
1123619854 15:22177735-22177757 CATGCACAAATGAGTTTTTTTGG + Intergenic
1123773932 15:23557878-23557900 CATTCACACAAGCTTTTATGTGG - Intergenic
1126431443 15:48589442-48589464 CACACACACTCGTTTTTTTGTGG - Intronic
1126891412 15:53208664-53208686 CATACACACATGCTCTAATGAGG - Intergenic
1126903639 15:53340508-53340530 CATGAACTCATCATTTTTTGTGG + Intergenic
1126906045 15:53367009-53367031 CACACACACATTATTGGTTGTGG + Intergenic
1127371716 15:58347755-58347777 CATAAACTCATCATTTTTTATGG - Intronic
1128420092 15:67483785-67483807 CATCCACACACAAATTTTTGGGG - Intronic
1128427525 15:67557020-67557042 CAAACACACAGGATTTTTTATGG - Intronic
1129883782 15:79025007-79025029 CACACACACATGCCTTTTAGGGG + Intronic
1129962675 15:79702058-79702080 TATACAAAAATGAGTTTTTGAGG + Intergenic
1130177264 15:81586652-81586674 CATAAACTCATCATTTTTTATGG - Intergenic
1130177519 15:81590496-81590518 CATAGAGAAATGACTTTTTGAGG - Intergenic
1130830489 15:87593703-87593725 CATGCACTCATCATTTTTTATGG - Intergenic
1131318832 15:91367063-91367085 CATGAACTCATCATTTTTTGTGG - Intergenic
1131339129 15:91579829-91579851 CATGCACTCATCATTTTTTATGG + Intergenic
1131461988 15:92624029-92624051 CATAGACACAAGAATTTTTAAGG + Intronic
1131638026 15:94258408-94258430 TAGACACAGATGCTTTTTTGTGG - Intronic
1131677586 15:94686256-94686278 CATGCACTCATGAGTTTTTTCGG + Intergenic
1132215326 15:100057932-100057954 CATTCACACATGCTTTTTGGAGG + Intronic
1132481980 16:171175-171197 AATAAAGTCATGATTTTTTGGGG - Intergenic
1135166342 16:20142477-20142499 CACACACACACAATTTTTTGTGG + Intergenic
1135225942 16:20657930-20657952 CATGAACTCATCATTTTTTGTGG + Intronic
1137442263 16:48507629-48507651 CTTCAACACATGAATTTTTGAGG + Intergenic
1138625111 16:58245289-58245311 GACCCACACATGATTTTTAGGGG - Intronic
1138855579 16:60687371-60687393 CATGGACTCATCATTTTTTGTGG - Intergenic
1138879640 16:60995385-60995407 AATACACTCATGATATTTTATGG + Intergenic
1139064576 16:63297058-63297080 TATATACTTATGATTTTTTGTGG + Intergenic
1139579450 16:67863773-67863795 CAGACCCACATGTTTTTCTGTGG - Intronic
1139719619 16:68842043-68842065 CACACACACAAGATTTTATTCGG + Intergenic
1140698458 16:77558949-77558971 CAAACATACATGGATTTTTGTGG + Intergenic
1140700557 16:77577634-77577656 CATATACATAGGGTTTTTTGAGG + Intergenic
1140944570 16:79755978-79756000 CATAAACTCATCATTTTTTATGG - Intergenic
1141819146 16:86432980-86433002 CATGCACACATGATCCTCTGGGG - Intergenic
1142941615 17:3384473-3384495 CAAACAGACATGATGTTGTGTGG - Intergenic
1144219809 17:13089631-13089653 CATAAACATATAAATTTTTGGGG + Intergenic
1145181242 17:20754762-20754784 CCTACACAAATGATCTTTTAGGG + Intergenic
1146137031 17:30331440-30331462 GATAAACAGATGATTATTTGGGG + Intronic
1149080864 17:52655487-52655509 CATGAACTCATCATTTTTTGTGG + Intergenic
1149840811 17:59963460-59963482 CCTACACAAATGATCTTTTAGGG + Intronic
1150935744 17:69633632-69633654 CATGAACACATCATTTTTTATGG - Intergenic
1150961969 17:69923500-69923522 CATAAACTCATCATTTTTTATGG + Intergenic
1151245129 17:72788612-72788634 AATACACACATAATTTTGGGAGG + Intronic
1151346009 17:73501689-73501711 CCTACACACGTGATTTTCTAGGG + Intronic
1151512843 17:74571871-74571893 CTTCCACATATGAATTTTTGGGG - Intergenic
1151630015 17:75304196-75304218 CATTTAGACATGATTTCTTGAGG + Intergenic
1152154840 17:78626122-78626144 TGTACGGACATGATTTTTTGGGG - Intergenic
1153179339 18:2415392-2415414 CACACACGCATGACTTTTGGGGG + Intergenic
1154056615 18:11018805-11018827 CATACCCACATATCTTTTTGAGG + Intronic
1154125834 18:11690782-11690804 CATGAACTCATGATTTTTTATGG + Intronic
1154223146 18:12474828-12474850 CTTCCAAACATGGTTTTTTGGGG - Intronic
1154354984 18:13618028-13618050 CATATACACATGCAATTTTGTGG + Intronic
1155217797 18:23658659-23658681 CTTGAACACATGAATTTTTGGGG - Intronic
1156024705 18:32638600-32638622 CATGAACTCATCATTTTTTGTGG + Intergenic
1156746276 18:40395297-40395319 CCTTAACAGATGATTTTTTGAGG + Intergenic
1156820439 18:41365802-41365824 TATACATACATGAGTGTTTGTGG - Intergenic
1156961612 18:43038656-43038678 CATCTACACACGATTATTTGAGG + Intronic
1157510598 18:48269440-48269462 CTTCAACACATGATTTTGTGGGG + Intronic
1158032904 18:52988793-52988815 CACACACATGTAATTTTTTGTGG + Intronic
1158886571 18:61833559-61833581 CACACAAACATGATTTCCTGAGG + Intronic
1159558105 18:69966261-69966283 CATGAACTCATCATTTTTTGTGG - Intergenic
1159629382 18:70731919-70731941 AATACTCAAATGATTTTTTCTGG + Intergenic
1159635519 18:70800324-70800346 CATGAACTCATGATTTTTTATGG - Intergenic
1159996941 18:74974000-74974022 CTTTAACACATGAATTTTTGAGG + Intronic
1162247361 19:9412987-9413009 CATACACACATTAAGGTTTGTGG + Exonic
1162297062 19:9820516-9820538 CACACACACATTTTTTTTTTTGG - Intronic
1163050857 19:14682633-14682655 GATATGCACATGCTTTTTTGGGG + Intronic
1163212159 19:15849022-15849044 CTTCAACACATGAATTTTTGGGG + Intergenic
1163760050 19:19131521-19131543 CACACACACACAATTTTTTGGGG + Intronic
1164067374 19:21729951-21729973 TATACACACATGTTCTTTTTTGG - Intronic
1164360371 19:27501293-27501315 CATAAACTCATCATTTTTTATGG + Intergenic
1164796827 19:31040293-31040315 CATACACACACGATTTTCACAGG - Intergenic
1164846938 19:31440261-31440283 CATACATAGATGGATTTTTGGGG - Intergenic
1165330301 19:35138252-35138274 CATACATACATGGTTTTGTCTGG + Intronic
1165695311 19:37896208-37896230 CATACACACGGCATATTTTGAGG + Intronic
1166340175 19:42132579-42132601 CACACACACATGATTTGGGGTGG - Intronic
1166699396 19:44873650-44873672 CACACACACATTATTTGTAGTGG + Intronic
1166757911 19:45205156-45205178 CACACACACACAATTTCTTGTGG - Intronic
1167762062 19:51455893-51455915 CATGAACTCATCATTTTTTGTGG - Intronic
925220747 2:2138512-2138534 CATGAACTCATCATTTTTTGTGG - Intronic
925930450 2:8703135-8703157 CATACAGACACCATTTTGTGAGG + Intergenic
926429866 2:12774773-12774795 CTTACACAAATGATTTCTTATGG + Intergenic
926476628 2:13330233-13330255 CATACACGTATGAATTTTGGGGG + Intergenic
926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG + Intergenic
927003343 2:18822591-18822613 CATGAACTCATCATTTTTTGTGG + Intergenic
927530491 2:23793830-23793852 CATACATAAAAGCTTTTTTGGGG - Intronic
928390846 2:30909878-30909900 CATGCACTCATCATTTTTTATGG - Intergenic
928860119 2:35847152-35847174 CATACTCATATCATTTTTAGAGG - Intergenic
928876305 2:36043773-36043795 CATGCACATATGATATTGTGTGG + Intergenic
929394901 2:41511360-41511382 CATAAACTCATCATTTTTTATGG + Intergenic
929708800 2:44244893-44244915 CATATACACATGTATTTTTAGGG + Intergenic
930466057 2:51751057-51751079 CATAAACTCATCCTTTTTTGTGG + Intergenic
930828804 2:55720743-55720765 CATTCAAAAATGATTTGTTGCGG - Intergenic
931782326 2:65589569-65589591 GACACACACAAGATTTATTGGGG + Intergenic
932097373 2:68863549-68863571 CATACACACATCATGTTATATGG + Intergenic
932590105 2:73060248-73060270 CATATCCCCATCATTTTTTGGGG - Intronic
932985645 2:76723158-76723180 CATGAACTCATAATTTTTTGTGG + Intergenic
932994764 2:76837754-76837776 CATGAACTCATAATTTTTTGTGG - Intronic
933028494 2:77294043-77294065 CATACACACATGCATCTATGTGG - Intronic
933035080 2:77386441-77386463 CATAAACTCATTATTTTTTATGG + Intronic
933506906 2:83188257-83188279 CACACACACATACTTTTTTAAGG - Intergenic
933935226 2:87198517-87198539 CATACCCTCAGGATTTTTTGAGG - Intergenic
934632704 2:95946726-95946748 CATGAACTCATCATTTTTTGTGG - Intronic
934639167 2:96016510-96016532 CAAACACACATTTTTTTTTTTGG + Intergenic
934805910 2:97226073-97226095 CATGCACACATATGTTTTTGCGG - Intronic
934930532 2:98418875-98418897 CATACACACGTGTTTGATTGAGG + Intergenic
934992937 2:98934093-98934115 AATCCACATATGAATTTTTGGGG + Intronic
935569656 2:104645755-104645777 CATGAACTCATCATTTTTTGTGG - Intergenic
935998538 2:108800950-108800972 CATAAACTCATCATTTTTTATGG + Intronic
936088428 2:109485738-109485760 CAAACACACATGGCTTTTTCTGG + Intronic
936357923 2:111767382-111767404 CATACCCTCAGGATTTTTTGAGG + Intronic
936642712 2:114333431-114333453 CATGAACACATCATTTTTTATGG + Intergenic
936644758 2:114356074-114356096 CATAAACTCATCATTTTTTATGG + Intergenic
936845804 2:116831474-116831496 CATAAACTCATCATTTTTTATGG - Intergenic
936850298 2:116888666-116888688 CATATACTCATCATTTTTTGTGG + Intergenic
937509966 2:122584244-122584266 CATGCACTCATCATTTTTTATGG - Intergenic
937519625 2:122696261-122696283 CATAAACTCATCATTTTTTATGG + Intergenic
938245452 2:129773488-129773510 CATCTACATATGATTTTTTGTGG + Intergenic
939270088 2:139928109-139928131 CATGAACTCATCATTTTTTGTGG + Intergenic
939345916 2:140966003-140966025 CATGCACACATAGTTTATTGTGG - Intronic
939392399 2:141585411-141585433 CACACACACACGATTATTTCAGG - Intronic
939435220 2:142167526-142167548 CATGAACTCATCATTTTTTGTGG + Intergenic
939774778 2:146370976-146370998 AATACACACAGGAATTTTTATGG + Intergenic
939930337 2:148226435-148226457 CATAAACTCATCATTTTTTATGG + Intronic
940413913 2:153398245-153398267 CATAAACTCATCATTTTTTGTGG + Intergenic
940416944 2:153434152-153434174 CATAAACTCATCATTTTTTATGG + Intergenic
940715173 2:157214056-157214078 CCTTCACAGATTATTTTTTGTGG + Intergenic
941120661 2:161526542-161526564 CATGAACTCATCATTTTTTGTGG + Intronic
941409909 2:165142000-165142022 AATACACACAGAATTATTTGGGG - Intronic
942353771 2:175084311-175084333 CATGAACACATCATTTTTTATGG - Intronic
942684376 2:178515972-178515994 CATAAGCACATGAATTTTTTTGG + Exonic
943217959 2:185063233-185063255 CATGAACTCATGATTTTTTATGG + Intergenic
943402635 2:187434605-187434627 CATATGTCCATGATTTTTTGAGG - Intronic
943972095 2:194423543-194423565 CATGAACTCATCATTTTTTGTGG - Intergenic
944542547 2:200767453-200767475 CAGACAGACATGAATTTTAGGGG + Intergenic
945204419 2:207316809-207316831 AATACACACATAATTTACTGTGG - Intergenic
946507261 2:220315077-220315099 CATACACACTGGACTTTGTGTGG + Intergenic
946660085 2:221990245-221990267 CATGAACACATCATTTTTTATGG - Intergenic
947694882 2:232177128-232177150 CATAAACTCATCATTTTTTATGG + Intronic
947928656 2:233943386-233943408 CATGAACTCATCATTTTTTGTGG - Intronic
1169849484 20:10034410-10034432 CCTCCACACATGCTTTTTGGCGG - Intronic
1170675842 20:18480039-18480061 CATATACACCTTCTTTTTTGAGG - Exonic
1171740231 20:28875393-28875415 CATAAACTCATCATTTTTTGTGG - Intergenic
1171799438 20:29598133-29598155 GATACACACATTTTTTCTTGTGG + Intergenic
1171809199 20:29726987-29727009 CATGCACTCATCATTTTTTATGG - Intergenic
1171943312 20:31352019-31352041 CATAAACTCATCATTTTTTATGG - Intergenic
1173093802 20:40003785-40003807 GATAAACACATGATTTGGTGAGG + Intergenic
1173477464 20:43371395-43371417 CATAAACTCATCATTTTTTATGG - Intergenic
1174195780 20:48771891-48771913 CCTAGACACATCATTTTTAGAGG - Intronic
1176349601 21:5782006-5782028 CATACACACTTGATCTTTCAAGG - Intergenic
1176356415 21:5902590-5902612 CATACACACTTGATCTTTCAAGG - Intergenic
1176543922 21:8180076-8180098 CATACACACTTGATCTTTCAAGG - Intergenic
1176562873 21:8363121-8363143 CATACACACTTGATCTTTCAAGG - Intergenic
1177699820 21:24623568-24623590 CATTCACACATTACTTTGTGGGG + Intergenic
1178572843 21:33756651-33756673 CATAAATACATGCTTATTTGGGG - Intronic
1180435679 22:15301184-15301206 CATGAACTCATGATTTTTTATGG - Intergenic
1180567937 22:16691156-16691178 CACACACACATGCTTTTTTTGGG - Intergenic
1181656804 22:24308048-24308070 TATACACACATAGTTTTTTTGGG + Intronic
1181674004 22:24440255-24440277 AATTAACGCATGATTTTTTGAGG - Intronic
1182398165 22:30052124-30052146 AATAAACACAGGATTTTTAGGGG + Intergenic
1182798812 22:33013535-33013557 CTCACACACATCATTTTCTGTGG + Intronic
1185294860 22:50048106-50048128 CACACACACACACTTTTTTGGGG - Intronic
1203248791 22_KI270733v1_random:96298-96320 CATACACACTTGATCTTTCAAGG - Intergenic
1203324053 22_KI270737v1_random:100198-100220 CACAAACTCATCATTTTTTGTGG + Intergenic
949383967 3:3479236-3479258 CACAGACAAATAATTTTTTGAGG + Intergenic
949525277 3:4897318-4897340 CATTCATACATGATTTTTACTGG + Intergenic
949652431 3:6175616-6175638 CATGAACTCATCATTTTTTGTGG + Intergenic
950258610 3:11527104-11527126 CATATACACACATTTTTTTGAGG + Intronic
950268717 3:11595654-11595676 CATAAACTCATCATTTTTTATGG - Intronic
950725916 3:14917014-14917036 CATACTCACACGACTTCTTGAGG + Intronic
950946507 3:16954349-16954371 CATGCACTCATCATTTTTTATGG + Intronic
950971831 3:17196943-17196965 CATTCACCCATTATTTCTTGAGG - Intronic
951163891 3:19461508-19461530 CAGTCACACAGGATTTTCTGTGG + Intronic
951329792 3:21353316-21353338 CATAAACTCATCCTTTTTTGTGG - Intergenic
951438220 3:22689837-22689859 CATGAACTCATCATTTTTTGTGG - Intergenic
951528370 3:23675394-23675416 GATTCACCCATGACTTTTTGTGG + Intergenic
951850542 3:27134651-27134673 CTTACTCAAATGAGTTTTTGAGG - Intronic
952099965 3:29999576-29999598 CATGAACTCATCATTTTTTGTGG - Intronic
952514235 3:34088159-34088181 CATGAACTCATCATTTTTTGTGG + Intergenic
952692826 3:36230076-36230098 CAGACACAAATGATTTATTGAGG + Intergenic
952770889 3:36999183-36999205 CATGAACTCATCATTTTTTGTGG + Intronic
953074590 3:39557018-39557040 CATGAACTCATGATTTTTTATGG - Intergenic
953091443 3:39730296-39730318 CATAAACTCATCATTTTTTATGG + Intergenic
953115053 3:39984549-39984571 CATAAACGCATCATTTTTTATGG + Intronic
955039002 3:55296718-55296740 CACACACACATCCTATTTTGTGG - Intergenic
955505545 3:59629509-59629531 CATAAACTCATCATTTTTTACGG - Intergenic
956215908 3:66848601-66848623 CATGAACTCATCATTTTTTGTGG - Intergenic
956243942 3:67160087-67160109 CATAAACTCATGCTTTTTTATGG - Intergenic
957103115 3:75852599-75852621 CATGCACTCATCATTTTTTATGG - Intergenic
957252215 3:77787592-77787614 CATACACACATAATATATTTGGG - Intergenic
957368287 3:79255671-79255693 CACACACACATAATATTTTGTGG + Intronic
957647685 3:82954152-82954174 CATAAACTCATCATTTTTTATGG + Intergenic
957855144 3:85865361-85865383 CATACACACATTTTATTTGGAGG - Intronic
957978902 3:87482473-87482495 CATAAACTCATCATTTTTTATGG - Intergenic
959101439 3:102014013-102014035 CATGAACTCATCATTTTTTGTGG - Intergenic
959429957 3:106241199-106241221 CATACAGACATAATTATATGTGG + Intergenic
960730889 3:120725615-120725637 CATGAACTCATCATTTTTTGTGG - Intronic
962175886 3:133154529-133154551 CATAAACTCATCATTTTTTATGG - Intronic
962183482 3:133233362-133233384 CATAAACTCATCATTTTTTATGG + Intronic
963261983 3:143202095-143202117 TATACGCTCATGATATTTTGTGG + Intergenic
964908253 3:161744780-161744802 CACACACACATGAGTTTATTAGG - Intergenic
965186487 3:165471924-165471946 CATGAACTCATCATTTTTTGTGG + Intergenic
965648103 3:170906006-170906028 CATGCAAACATACTTTTTTGTGG - Intronic
967285800 3:187868171-187868193 CATAAACTCATCATTTTTTATGG - Intergenic
967768031 3:193303914-193303936 CACACACACATAATTTTTGCTGG + Intronic
968730137 4:2265630-2265652 CACACACACATGACTTCTCGGGG + Intergenic
970015191 4:11505198-11505220 CATACACACAGGATCTTATTTGG - Intergenic
970305196 4:14724521-14724543 CATAAACTCATTATTTTTTGTGG - Intergenic
970805181 4:20022790-20022812 CATACACATAACATTTATTGCGG + Intergenic
971535500 4:27743750-27743772 CATACATACATAATTTTTATAGG + Intergenic
971890659 4:32517159-32517181 CATGAACTCATCATTTTTTGTGG + Intergenic
971895263 4:32584907-32584929 CATAAACTCATCCTTTTTTGTGG + Intergenic
971949533 4:33327207-33327229 GACACAAATATGATTTTTTGAGG + Intergenic
971985245 4:33813702-33813724 TATACAAACATGATTTTTCCAGG - Intergenic
972045071 4:34655207-34655229 CATAAACTCATCATTTTTTATGG - Intergenic
972130677 4:35829756-35829778 CATAAACTCATCATTTTTTATGG + Intergenic
972248399 4:37271975-37271997 CATATATTCCTGATTTTTTGAGG + Intronic
972623450 4:40772084-40772106 CATGTACACTTTATTTTTTGTGG + Intronic
972709029 4:41575049-41575071 CACACACACACAATTTATTGAGG + Intronic
972822855 4:42722366-42722388 CAGAAACACATGACATTTTGAGG - Intergenic
972905817 4:43745789-43745811 CATGAACTCATGCTTTTTTGTGG - Intergenic
974470720 4:62315046-62315068 CATGAACTCATCATTTTTTGTGG - Intergenic
974514649 4:62894053-62894075 CACACACACAATATTTTTTGTGG + Intergenic
974689411 4:65276886-65276908 GATACACACATGATCTCTAGGGG - Intergenic
974696082 4:65374001-65374023 CAAACACAGATGAATATTTGAGG + Intronic
974787759 4:66642732-66642754 CAAAGACAAATGTTTTTTTGGGG - Intergenic
975012438 4:69374183-69374205 CATGAACTCATCATTTTTTGTGG - Intronic
975103257 4:70538713-70538735 CATACACACATGAAATCATGTGG - Intergenic
975244436 4:72103152-72103174 CAAACACAAATGATTTATTAAGG + Intronic
975260077 4:72287631-72287653 CAGCCACACATGCTTTTTCGAGG - Intronic
975302975 4:72813210-72813232 CATAAACTCATCATTTTTTATGG - Intergenic
975534045 4:75430297-75430319 CTCACATACATCATTTTTTGTGG + Intergenic
975561861 4:75716097-75716119 CCTACACACATGACCTTTTCAGG - Intronic
976026455 4:80693365-80693387 CATAAACTCATCATTTTTTATGG - Intronic
976083451 4:81382280-81382302 CACACACATATTATTATTTGTGG - Intergenic
976484348 4:85584259-85584281 CATGAACTCATCATTTTTTGTGG - Intronic
976487241 4:85622419-85622441 CATGAACTCATCATTTTTTGTGG + Intronic
976518963 4:86004400-86004422 CACACACACAGGGTGTTTTGTGG + Intergenic
976863759 4:89699163-89699185 TATACACAGATGATTTCTTGTGG + Intergenic
976891313 4:90050961-90050983 CAAACACACAGGGTTTTCTGTGG - Intergenic
977280106 4:95029420-95029442 CATGAACACATCATTTTTTATGG + Intronic
977388559 4:96377687-96377709 TTTACACAGATGATTTTTTTTGG + Intergenic
977770360 4:100850762-100850784 CACACACACATGCATTTTAGTGG + Intronic
978781049 4:112554497-112554519 CATGAACTCATCATTTTTTGTGG - Intronic
979293571 4:119004549-119004571 CATAAACTCATCATTTTTTATGG + Intronic
979391083 4:120128596-120128618 CATAAACTCATCATTTTTTATGG - Intergenic
979926149 4:126567251-126567273 CATGAACTCATCATTTTTTGTGG + Intergenic
979951922 4:126903552-126903574 CATACATACATCAGTTTTGGGGG + Intergenic
980656288 4:135791602-135791624 CATACACTCATCATTTTCTCAGG - Intergenic
981069650 4:140521691-140521713 CATGAACTCATGATTTTTTATGG - Intergenic
981113030 4:140957718-140957740 CATAAACTCATCATTTTTTATGG - Intronic
982141875 4:152330387-152330409 ACTCCAAACATGATTTTTTGAGG - Intronic
982333880 4:154212469-154212491 CATGAACTCATCATTTTTTGTGG + Intergenic
982752662 4:159180728-159180750 CATATAATCATGATTTTTAGGGG - Intronic
982893364 4:160884088-160884110 CATGAACTCATCATTTTTTGTGG - Intergenic
982920130 4:161263589-161263611 CATACACACTTGTTTTTTCAGGG + Intergenic
982998300 4:162379973-162379995 CATGCACTCATCATTTTTTATGG - Intergenic
983377940 4:166953753-166953775 CATGAACTCATCATTTTTTGTGG - Intronic
983393311 4:167161708-167161730 CATGAACTCATCATTTTTTGTGG - Intronic
983823082 4:172221406-172221428 CAAACACTCATGGTTTTCTGGGG - Intronic
983846977 4:172532576-172532598 CAAAAATACATGATTATTTGTGG - Intronic
984462071 4:180050920-180050942 CATAAAAACATGATTTCTTTGGG + Intergenic
984857032 4:184204248-184204270 CATAAACACATGGGTTTTGGGGG + Intronic
985272564 4:188207912-188207934 CACACACACACACTTTTTTGTGG - Intergenic
985745861 5:1647244-1647266 CATAAACTCATCATTTTTTATGG - Intergenic
985906603 5:2842546-2842568 CATACACACATGACATCATGGGG - Intergenic
986366218 5:7034812-7034834 CATAGACACATGATTTGCTAAGG - Intergenic
986371434 5:7084258-7084280 CATGAACTCATGATTTTTTATGG + Intergenic
987200041 5:15567919-15567941 CATATACTCATCATTTTTTATGG + Intronic
987401402 5:17480934-17480956 CATATATATATAATTTTTTGAGG + Intergenic
987553495 5:19414525-19414547 CACACACACCTTATTTTATGAGG - Intergenic
987722624 5:21657960-21657982 CATAAACTCATCATTTTTTATGG - Intergenic
988282332 5:29166017-29166039 CCAACACACATGAATTTTTAAGG + Intergenic
988321635 5:29705320-29705342 CATGAACTCATCATTTTTTGTGG - Intergenic
988660576 5:33263088-33263110 CATGAACTCATGATTTTTTATGG - Intergenic
989043786 5:37254479-37254501 CATACACACATAGTTTACTGTGG + Intergenic
989976339 5:50591713-50591735 AATACAGTCATGATTTTTTCAGG + Intergenic
990053944 5:51546174-51546196 TGTACACACATGATTTTTGTAGG + Intergenic
990706567 5:58536475-58536497 CATGAACACATCATTTTTTATGG + Intergenic
990883869 5:60569873-60569895 CATGAACTCATCATTTTTTGTGG + Intergenic
991025720 5:62027165-62027187 CATAAACTCATCATTTTTTATGG + Intergenic
991076596 5:62546266-62546288 CATAAACTCATCATTTTTTATGG - Intronic
991211021 5:64104836-64104858 CATGAACTCATCATTTTTTGTGG - Intergenic
991454624 5:66789214-66789236 CATACACACATGATTTTTTGAGG + Intronic
992040754 5:72828520-72828542 CATACACACACAAATTTTTGGGG + Intronic
992273168 5:75086898-75086920 CACACACACATGCATGTTTGAGG + Intronic
992559712 5:77938872-77938894 CACACTCACATGATTTTGTATGG - Intergenic
993069931 5:83147710-83147732 CACATACTTATGATTTTTTGTGG - Intronic
993289639 5:86049384-86049406 CATGCACTCATCATTTTTTATGG - Intergenic
993619614 5:90152542-90152564 CATGAACTCATCATTTTTTGTGG - Intergenic
993900841 5:93583588-93583610 TATACATATATGATTTTTTTTGG + Exonic
994445440 5:99866876-99866898 CATATTCACATGATCATTTGAGG - Intergenic
994535235 5:101022129-101022151 CATGAACTCATCATTTTTTGTGG - Intergenic
994589608 5:101757331-101757353 CATATACTTATCATTTTTTGTGG + Intergenic
994759465 5:103835138-103835160 CTTTCACATATGAATTTTTGGGG - Intergenic
994813540 5:104555049-104555071 CAAACACAGATGATTTATTTTGG + Intergenic
994928267 5:106147364-106147386 CATGAACTCATCATTTTTTGTGG - Intergenic
995681100 5:114720504-114720526 CATGAACTCATCATTTTTTGTGG + Intergenic
996497451 5:124177064-124177086 CAGACACACATGATTAATTGAGG - Intergenic
996501277 5:124218969-124218991 CATGAACTCATCATTTTTTGTGG - Intergenic
996609208 5:125359324-125359346 CATGAACTCATTATTTTTTGTGG + Intergenic
996959819 5:129233865-129233887 CATGAACTCATGATTTTTTATGG + Intergenic
997056160 5:130447671-130447693 CATAAACTCATTCTTTTTTGTGG - Intergenic
997292274 5:132746787-132746809 CATACATACATAAATTTTAGGGG - Intergenic
998574208 5:143295959-143295981 CCTACACACTTGATTTTTAAAGG + Intronic
998780995 5:145656570-145656592 CATGAACTCATGATTTTTTATGG - Intronic
998827760 5:146121644-146121666 CATAAACTCATCATTTTTTATGG - Intronic
999338778 5:150748605-150748627 CATGAACTCATCATTTTTTGTGG - Intronic
1000505274 5:162109060-162109082 CATAAACTCATCATTTTTTATGG - Intronic
1002768144 6:261534-261556 AATACACAGAAGATTTTTTTAGG - Intergenic
1003768464 6:9268503-9268525 CATGAACTCATGATTTTTTATGG + Intergenic
1003813972 6:9816432-9816454 CATGAACTCATCATTTTTTGTGG - Intronic
1004730553 6:18354105-18354127 CATGAACTCATCATTTTTTGTGG + Intergenic
1005365666 6:25074151-25074173 CATGAACTCATCATTTTTTGTGG + Intergenic
1005527715 6:26667568-26667590 CATACACATTTCATTTTTAGGGG + Intergenic
1006890960 6:37428123-37428145 AATACACACATTATTTACTGTGG - Intergenic
1007155807 6:39742223-39742245 CATAAACTCATCATTTTTTATGG - Intergenic
1007860751 6:44905842-44905864 CATGCACTCATCATTTTTTATGG - Intronic
1008286904 6:49664236-49664258 CATAAACTCATCATTTTTTATGG - Intergenic
1009349556 6:62657494-62657516 AATACACACATTATTTATTTAGG - Intergenic
1009414919 6:63405128-63405150 CATGAACTCATCATTTTTTGTGG + Intergenic
1009554220 6:65141160-65141182 CATGAACTCATCATTTTTTGTGG - Intronic
1009601317 6:65803948-65803970 CATGAACTCATCATTTTTTGTGG + Intergenic
1009612341 6:65962656-65962678 TATACAATCATTATTTTTTGTGG - Intergenic
1009801042 6:68536729-68536751 CATAAACTCATCATTTTTTGTGG + Intergenic
1010081530 6:71869566-71869588 CACACACTCATGATTCTTTATGG + Intergenic
1010348002 6:74835863-74835885 CATAAACTCATCATTTTTTATGG + Intergenic
1011104246 6:83761448-83761470 CATATAAAAAAGATTTTTTGGGG - Intergenic
1011155900 6:84331336-84331358 CAAATACTTATGATTTTTTGTGG - Intergenic
1011908017 6:92397110-92397132 CATAGAAACATGATGGTTTGGGG + Intergenic
1012344508 6:98169802-98169824 CAAACACACTGGATTTATTGGGG + Intergenic
1012541150 6:100363301-100363323 CATATAGAAATGGTTTTTTGAGG - Intergenic
1013294914 6:108750430-108750452 CACACACACATGCTTGCTTGTGG - Intergenic
1013756017 6:113462648-113462670 CTTTCACATATGAATTTTTGGGG - Intergenic
1013971095 6:116019296-116019318 AATAAACAGATGATTATTTGAGG + Intronic
1015178996 6:130341750-130341772 CATGGAAACATGATCTTTTGAGG + Intronic
1015448006 6:133330584-133330606 CACACACACATACTTTTTTGGGG + Intronic
1016587973 6:145710789-145710811 CATGAACTCATTATTTTTTGTGG - Intronic
1017292909 6:152762072-152762094 CTTTCACATATGAATTTTTGGGG + Intergenic
1017341819 6:153332818-153332840 CATACAGACATGACTTGTTTGGG + Intergenic
1017562085 6:155639058-155639080 CAGACACACACGATTTATTAGGG + Intergenic
1017639946 6:156483292-156483314 CATAAACTCATCATTTTTTATGG - Intergenic
1017830558 6:158124507-158124529 CTTATACATATCATTTTTTGTGG - Intronic
1018527249 6:164726462-164726484 CATACACACATTAGTCATTGTGG - Intergenic
1018706477 6:166467394-166467416 CAGAAACACATGGTATTTTGAGG + Intronic
1018927414 6:168215848-168215870 CTTAGACACAATATTTTTTGGGG + Intergenic
1019069269 6:169328773-169328795 CATCCAGACATGACCTTTTGAGG + Intergenic
1020191813 7:6005847-6005869 CATTCACAGATCATTTCTTGTGG + Intronic
1020247035 7:6437611-6437633 CATAGACAGTTGTTTTTTTGTGG + Intronic
1020937286 7:14483527-14483549 CACACAGACATGAATCTTTGGGG + Intronic
1023523817 7:41077787-41077809 CACACACACTTGATTATTTCTGG + Intergenic
1024546888 7:50529843-50529865 CTTCAACACATGAATTTTTGGGG - Intronic
1024723903 7:52170432-52170454 CATTCACATATGGGTTTTTGTGG - Intergenic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026560073 7:71441379-71441401 CATACACAAATGACCATTTGTGG + Intronic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1027507450 7:79035178-79035200 CACACACACACTTTTTTTTGTGG - Intronic
1027634393 7:80651912-80651934 AATTCAAACATAATTTTTTGCGG - Intronic
1028320902 7:89459327-89459349 CATAAACTCATCATTTTTTATGG + Intergenic
1028621650 7:92834343-92834365 CATACACAAATGGTCTTTTTGGG + Intronic
1028692252 7:93666116-93666138 CATTTAGACATTATTTTTTGAGG - Intronic
1029869607 7:103676707-103676729 CATGAACTCATCATTTTTTGTGG - Intronic
1029875566 7:103747081-103747103 CATGAACTCATCATTTTTTGTGG - Intronic
1030507754 7:110446000-110446022 CTTACACACAGATTTTTTTGTGG + Intergenic
1030897519 7:115079333-115079355 CACACACACACAATTTTTTCTGG + Intergenic
1030937576 7:115604251-115604273 CATACATACATGTCTTTATGTGG + Intergenic
1032007142 7:128311792-128311814 CCTACATAAATGATATTTTGTGG + Intronic
1032722178 7:134559270-134559292 TATACATGCTTGATTTTTTGTGG - Intronic
1033144748 7:138861481-138861503 GAATCACACATGAGTTTTTGTGG + Intronic
1033982958 7:147188388-147188410 CATACACGCATGATATTTTGTGG + Intronic
1035217753 7:157381969-157381991 CATACACACATTCTTTATGGAGG - Intronic
1035347023 7:158207131-158207153 CATGCACTCATCATTTTTTATGG + Intronic
1035707344 8:1686886-1686908 CACACACACATAAATGTTTGAGG + Intronic
1036676810 8:10840615-10840637 CATACTCACATTATTTTGCGAGG - Intergenic
1037066359 8:14582831-14582853 CATGAACTCATCATTTTTTGTGG + Intronic
1037079975 8:14772750-14772772 CATGAACTCATCATTTTTTGTGG + Intronic
1037195034 8:16178427-16178449 CATAAACTCATCCTTTTTTGTGG + Intronic
1037270314 8:17121010-17121032 TATCAACACATGACTTTTTGGGG - Exonic
1037544576 8:19906245-19906267 CATGAACTCATCATTTTTTGTGG + Intronic
1038116044 8:24556338-24556360 CATAAACTCATCATTTTTTATGG + Intergenic
1039176448 8:34812992-34813014 CATACACATATGGATTTCTGTGG + Intergenic
1040118171 8:43649026-43649048 CATAAACTCATCATTTTTTATGG - Intergenic
1040608030 8:48954225-48954247 CATAAACTCATCATTTTTTATGG + Intergenic
1040631904 8:49223860-49223882 CATAAACTCATCATTTTTTATGG + Intergenic
1040770002 8:50962337-50962359 CACACACACATAATTTTTTAAGG + Intergenic
1041057292 8:53999497-53999519 CACACACAAATTATTTTTTTCGG - Intronic
1041247667 8:55904539-55904561 CATACAGAAATTATTTTGTGTGG - Intronic
1041638079 8:60166174-60166196 CATAAACTCATCATTTTTTATGG - Intergenic
1042177848 8:66055180-66055202 CATACAAATATTATTTTTTCAGG + Intronic
1042479347 8:69286025-69286047 CATGCACTCATCCTTTTTTGTGG - Intergenic
1043119369 8:76303360-76303382 CATACATATATAATGTTTTGCGG + Intergenic
1043696701 8:83228660-83228682 CATACACAAATATTTGTTTGAGG - Intergenic
1043890794 8:85650725-85650747 CATGAACACATGCTTTTTTATGG + Intergenic
1043893694 8:85719778-85719800 CATGAACACATGCTTTTTTATGG - Intergenic
1043896374 8:85741227-85741249 CATGAACACATGCTTTTTTATGG - Intergenic
1043898627 8:85758948-85758970 CATGAACACATGCTTTTTTATGG + Intergenic
1043900240 8:85771142-85771164 CATGAACACATGCTTTTTTATGG + Intergenic
1043902202 8:85786417-85786439 CATGAACACATGCTTTTTTATGG + Intergenic
1043903811 8:85798610-85798632 CATGAACACATGCTTTTTTATGG + Intergenic
1043905423 8:85810804-85810826 CATGAACACATGCTTTTTTATGG + Intergenic
1043907032 8:85822991-85823013 CATGAACACATGCTTTTTTATGG + Intergenic
1044070411 8:87753132-87753154 CATGAACTCATCATTTTTTGTGG - Intergenic
1044283290 8:90381238-90381260 CATGCACTCATCATTTTTTATGG - Intergenic
1044551750 8:93520427-93520449 CATGAACTCATCATTTTTTGTGG - Intergenic
1044688985 8:94857845-94857867 CAGATACACATGAATTTTGGGGG + Intronic
1044878361 8:96696109-96696131 CATAAACTCATCATTTTTTATGG - Intronic
1045091132 8:98744399-98744421 CATGAACTCATTATTTTTTGTGG - Intronic
1046041535 8:108911666-108911688 CATACACACATAATTGTGTGTGG - Intergenic
1046725882 8:117673314-117673336 CATGAACTCATCATTTTTTGAGG + Intergenic
1047092768 8:121591821-121591843 CATCCACAAAATATTTTTTGGGG - Intergenic
1047481400 8:125286861-125286883 CACACACATATGATTTTCTTAGG - Intronic
1047674346 8:127184033-127184055 CATGAACCCATTATTTTTTGTGG - Intergenic
1047749530 8:127869744-127869766 CATACAGGCATGAATTTTGGGGG - Intergenic
1047797536 8:128273322-128273344 CTTTCACACGTCATTTTTTGGGG + Intergenic
1048240443 8:132736385-132736407 CACCCACTCATGATTTTCTGAGG - Intronic
1048684516 8:136889024-136889046 CATGAACTCATCATTTTTTGTGG + Intergenic
1048686197 8:136907693-136907715 CATACGCAGAGGATTTTTTGAGG - Intergenic
1048743757 8:137590764-137590786 CATAAACTCATCATTTTTTATGG + Intergenic
1048905820 8:139087372-139087394 CATGAACTCATCATTTTTTGTGG - Intergenic
1049475059 8:142793446-142793468 CATAGACACATGCTTTTTAAAGG + Intergenic
1049833378 8:144716774-144716796 CATCCTCACATACTTTTTTGTGG + Intergenic
1050141058 9:2515955-2515977 CATAAACTCATCATTTTTTATGG + Intergenic
1050677602 9:8073566-8073588 CATGAACTCATCATTTTTTGTGG + Intergenic
1050688543 9:8199325-8199347 CATGAACTCATCATTTTTTGTGG + Intergenic
1050708243 9:8428663-8428685 CACACACACACAATTTTTTTTGG - Intronic
1050769573 9:9180265-9180287 CATGAACTCATCATTTTTTGTGG - Intronic
1050846645 9:10229520-10229542 CATGAACTCATCATTTTTTGTGG - Intronic
1051298657 9:15624635-15624657 CATAAACTCATCATTTTTTATGG + Intronic
1051693187 9:19739119-19739141 CCTAGATAAATGATTTTTTGGGG - Intronic
1052169432 9:25375375-25375397 CTTATACACATGAATTTTGGAGG - Intergenic
1052556577 9:30026292-30026314 CATATACACAAGAATTTTGGAGG + Intergenic
1053704456 9:40736375-40736397 CATGAACTCATGATTTTTTATGG + Intergenic
1054414541 9:64859985-64860007 CATGTACTCATGATTTTTTATGG + Intergenic
1054784382 9:69196968-69196990 CACACACACATGTTTTCTGGAGG + Intronic
1055151271 9:73003632-73003654 CATTCAATCATGATTTGTTGAGG + Intronic
1055181604 9:73394319-73394341 CATACACACACACTATTTTGGGG + Intergenic
1055503324 9:76923475-76923497 GATAGAAAAATGATTTTTTGGGG + Intergenic
1056093029 9:83223255-83223277 CATAAACTCATCATTTTTTATGG + Intergenic
1057117319 9:92537946-92537968 AATACATACATTGTTTTTTGGGG + Intronic
1057586855 9:96336185-96336207 CATAGTCACATAATTATTTGAGG + Intronic
1057732802 9:97625094-97625116 AATACACAAGAGATTTTTTGAGG - Intronic
1059058707 9:111012727-111012749 CATTCACACTTGATCCTTTGAGG + Intronic
1059600159 9:115768408-115768430 CATGAACTCATCATTTTTTGTGG + Intergenic
1059726074 9:117009397-117009419 CATACACACACACTTTTTTTGGG + Intronic
1060083858 9:120679167-120679189 CATGCACACATTTATTTTTGCGG + Intronic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1060560894 9:124542362-124542384 CATACACTGATGATGTTTGGGGG - Intronic
1203465191 Un_GL000220v1:79546-79568 CATACACACTTGATCTTTCAAGG - Intergenic
1203412966 Un_KI270589v1:12769-12791 CATAAACTCATCTTTTTTTGTGG - Intergenic
1203685227 Un_KI270757v1:47102-47124 CATAAACTCATCTTTTTTTGTGG + Intergenic
1186146801 X:6632560-6632582 CTTCCACACATGAATTTTTGGGG + Intergenic
1186293476 X:8124050-8124072 CATACACACACACTTTTTTTTGG - Intergenic
1186910334 X:14157397-14157419 CATGAACTCATCATTTTTTGTGG - Intergenic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1188109155 X:26176866-26176888 CATGAACTCATCATTTTTTGTGG + Intergenic
1188669526 X:32866706-32866728 CATACACACACTTTTTTTTGGGG + Intronic
1188675120 X:32929885-32929907 CATAAACTCATAATTTTTTATGG + Intronic
1188697209 X:33208558-33208580 TAAACACACATCATTTTTTAAGG - Intronic
1188935483 X:36170619-36170641 CATGAACACATCATTTTTTATGG + Intergenic
1189056132 X:37701209-37701231 CATACACAGATTATTTTTTCTGG - Intronic
1189485408 X:41427014-41427036 CATGAACTCATCATTTTTTGTGG + Intergenic
1189639463 X:43051885-43051907 CACACACTCACCATTTTTTGTGG + Intergenic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190031502 X:46977682-46977704 CAAATGCACATGATTTATTGAGG + Intronic
1190047741 X:47126237-47126259 CATACTCACATGCTTTTTTCTGG + Intergenic
1191597055 X:62957167-62957189 CATGAACACATCATTTTTTATGG + Intergenic
1191627701 X:63286324-63286346 CATGAACACATCATTTTTTATGG + Intergenic
1191831775 X:65422856-65422878 CATAAACTCATCCTTTTTTGTGG + Intronic
1191838974 X:65496006-65496028 CAGAAATACTTGATTTTTTGAGG + Intronic
1191917054 X:66213473-66213495 CAAACACTCATCATTTTTTATGG - Intronic
1192964708 X:76165149-76165171 CATACACTCATCCTTTTTTATGG - Intergenic
1193010275 X:76667923-76667945 CATGAACTCATCATTTTTTGTGG - Intergenic
1193059514 X:77190267-77190289 CATGAACTCATCATTTTTTGTGG - Intergenic
1193207051 X:78761506-78761528 CATAAACTCATCATTTTTTATGG - Intergenic
1193566319 X:83081433-83081455 CATGAACTCATCATTTTTTGTGG + Intergenic
1193579698 X:83249757-83249779 CATATACTTATCATTTTTTGTGG + Intergenic
1193634085 X:83926684-83926706 CATAAACTCATTATTTTTTATGG + Intergenic
1193654039 X:84176373-84176395 AATACACACATGACATTCTGAGG + Intronic
1193810147 X:86041658-86041680 CATACACACATATGTTTTTGGGG - Intronic
1194385684 X:93251882-93251904 CATATACTTATAATTTTTTGTGG + Intergenic
1194621224 X:96175335-96175357 CATGAACTCATGATTTTTTATGG - Intergenic
1194992260 X:100557196-100557218 CATAAACTCATCATTTTTTATGG - Intergenic
1195103527 X:101580359-101580381 CATGAACTCATCATTTTTTGTGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1195224353 X:102777119-102777141 CATGAACTCATCATTTTTTGTGG + Intergenic
1195227340 X:102811288-102811310 CATGAACACATCATTTTTTATGG + Intergenic
1195779773 X:108449231-108449253 AATAAACTCATGATGTTTTGGGG + Intronic
1195957296 X:110345163-110345185 CATAAACTCATCATTTTTTATGG - Intronic
1196013600 X:110914339-110914361 CATACACAAAAGATGTTCTGTGG - Intergenic
1196015112 X:110931008-110931030 CATACATACATGTGTTTTTATGG - Intergenic
1196037375 X:111160789-111160811 CATGAACTCATCATTTTTTGTGG + Intronic
1196342281 X:114608891-114608913 CGTACACAAAAGTTTTTTTGAGG - Intronic
1196527791 X:116747611-116747633 CATGCACTCATCATTTTTTATGG + Intergenic
1197337775 X:125229193-125229215 CATACACACTTTAGCTTTTGTGG - Intergenic
1197480102 X:126973347-126973369 CATAAACTCATCATTTTTTATGG - Intergenic
1198043921 X:132880949-132880971 CATGCACTCATCATTTTTTATGG + Intronic
1198175847 X:134153567-134153589 CAGAAGCTCATGATTTTTTGAGG - Intergenic
1198300425 X:135329006-135329028 CATATTCTCATGCTTTTTTGTGG + Intronic
1199933706 X:152550917-152550939 CACACACACACCCTTTTTTGTGG + Intergenic
1200693118 Y:6328777-6328799 CATGAACTCATCATTTTTTGTGG + Intergenic
1200789284 Y:7285268-7285290 CATTGATATATGATTTTTTGGGG + Intergenic
1200814082 Y:7513707-7513729 CATGAACTCATCATTTTTTGTGG - Intergenic
1200872491 Y:8117677-8117699 CATAAACTCATCATTTTTTATGG - Intergenic
1200885949 Y:8269900-8269922 CATGAACTCATCATTTTTTGTGG - Intergenic
1201042154 Y:9845949-9845971 CATGAACTCATCATTTTTTGTGG - Intergenic
1201056214 Y:9994765-9994787 CATGAACTCATCATTTTTTGTGG - Intergenic
1201441980 Y:14018212-14018234 CATAAACTCATCATTTTTTATGG - Intergenic
1201442590 Y:14024495-14024517 CATAAACTCATCATTTTTTATGG + Intergenic
1201572707 Y:15431726-15431748 CATGAACTCATCATTTTTTGTGG - Intergenic
1201627993 Y:16036022-16036044 CTTCCACACATGAGTTTTAGGGG + Intergenic
1201664384 Y:16432748-16432770 CATAAACTCATCATTTTTTATGG - Intergenic
1201707870 Y:16956749-16956771 CGTACACACATTGATTTTTGTGG - Intergenic
1201976564 Y:19855780-19855802 CATGAACTCATCATTTTTTGTGG - Intergenic
1201993218 Y:20052853-20052875 CATAAACTCATTCTTTTTTGTGG + Intergenic