ID: 991456251

View in Genome Browser
Species Human (GRCh38)
Location 5:66807661-66807683
Sequence TTCCTCTATGCAGGGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991456251_991456255 -2 Left 991456251 5:66807661-66807683 CCCACTTTCCCTGCATAGAGGAA No data
Right 991456255 5:66807682-66807704 AATTTGCATTCTCATACTCATGG No data
991456251_991456257 8 Left 991456251 5:66807661-66807683 CCCACTTTCCCTGCATAGAGGAA No data
Right 991456257 5:66807692-66807714 CTCATACTCATGGGAACCGTAGG No data
991456251_991456256 -1 Left 991456251 5:66807661-66807683 CCCACTTTCCCTGCATAGAGGAA No data
Right 991456256 5:66807683-66807705 ATTTGCATTCTCATACTCATGGG 0: 1
1: 0
2: 1
3: 23
4: 247
991456251_991456258 9 Left 991456251 5:66807661-66807683 CCCACTTTCCCTGCATAGAGGAA No data
Right 991456258 5:66807693-66807715 TCATACTCATGGGAACCGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
991456251_991456259 16 Left 991456251 5:66807661-66807683 CCCACTTTCCCTGCATAGAGGAA No data
Right 991456259 5:66807700-66807722 CATGGGAACCGTAGGGCTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991456251 Original CRISPR TTCCTCTATGCAGGGAAAGT GGG (reversed) Intronic