ID: 991457773

View in Genome Browser
Species Human (GRCh38)
Location 5:66822860-66822882
Sequence GGTGTTAGGAGCCCAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991457771_991457773 -4 Left 991457771 5:66822841-66822863 CCAAGAGGCAGTAGAGCATGGTG 0: 1
1: 0
2: 7
3: 28
4: 214
Right 991457773 5:66822860-66822882 GGTGTTAGGAGCCCAAACTCTGG 0: 1
1: 0
2: 2
3: 14
4: 127
991457768_991457773 13 Left 991457768 5:66822824-66822846 CCTTCTTTGTTTAAACTCCAAGA 0: 1
1: 0
2: 1
3: 28
4: 362
Right 991457773 5:66822860-66822882 GGTGTTAGGAGCCCAAACTCTGG 0: 1
1: 0
2: 2
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991457773 Original CRISPR GGTGTTAGGAGCCCAAACTC TGG Intronic
902147793 1:14418202-14418224 GATATTAGGAGCTCAAATTCAGG + Intergenic
902636092 1:17735943-17735965 GGTGTGAAGAGCCCTGACTCTGG - Intergenic
902831281 1:19014534-19014556 GGTGAGAGGAAGCCAAACTCAGG + Intergenic
903518584 1:23929788-23929810 AGTGTTAAGAGCACAAGCTCTGG - Intergenic
904373143 1:30063385-30063407 AGTGTTAGGAGCCCCAAAGCTGG - Intergenic
904402300 1:30264796-30264818 GTGGTTAGGAGCCTAAGCTCTGG - Intergenic
904484676 1:30816750-30816772 GGTGGTAAGAGCACAAGCTCTGG + Intergenic
905684449 1:39898778-39898800 GGTGTTATGAGCCCCATATCTGG - Intronic
905921393 1:41721811-41721833 GGGGTTAGGAGCACAGATTCTGG - Intronic
906514832 1:46432786-46432808 GGGGTTTGGAACCCAAATTCTGG - Intergenic
908410229 1:63856874-63856896 TGTGTTAGGAGCCCTTTCTCTGG + Intronic
908995685 1:70150285-70150307 GTTGTTAAGAGCCCAACTTCTGG + Intronic
915052694 1:153093189-153093211 GGTGTTAGAAGCCCATGCCCAGG + Exonic
915687841 1:157653060-157653082 GATGATAGAAGACCAAACTCTGG + Intergenic
922302275 1:224311958-224311980 GTGGTTAAGAGTCCAAACTCTGG + Intronic
1063426277 10:5952622-5952644 GTGGTTAGAAGCCCAAACGCTGG + Exonic
1064156341 10:12906310-12906332 GGTGCCAGGAGCCCAAACAAAGG + Intronic
1067531053 10:47073384-47073406 GGTGTCTGCTGCCCAAACTCAGG + Intergenic
1069908508 10:71746265-71746287 GGTCTTAGCAGCCAAATCTCAGG - Intronic
1073079518 10:100850126-100850148 GTGGTTAGGAGCACAAGCTCTGG - Intergenic
1074400581 10:113138341-113138363 GGTGTTAGTAGCCAGAACACAGG + Intronic
1075435358 10:122436147-122436169 TGTGTTAAGAGCCCAAACTTTGG - Exonic
1075542665 10:123328573-123328595 GGTGTTAGGAGCCAAGACTCTGG + Intergenic
1076599649 10:131648865-131648887 GGTATGAGAAGACCAAACTCTGG - Intergenic
1079987549 11:27214911-27214933 GTTGTTAGGAGTCCAAGCTCTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082765505 11:57164370-57164392 GTGGTTAGGGGCACAAACTCTGG + Intergenic
1083582355 11:63832980-63833002 GGTGTTGGGAACCCAAAGGCTGG - Intergenic
1090893526 11:130948962-130948984 GTGGTTAAGAGCACAAACTCTGG + Intergenic
1098100301 12:67008539-67008561 GTGGTTATGAGCCCAGACTCTGG + Intergenic
1099420580 12:82454222-82454244 TGTGTTAGGAGCCCAACTTCTGG + Intronic
1101922580 12:108944770-108944792 GGTGTGAGTAGACCGAACTCTGG - Intronic
1102023512 12:109699934-109699956 GGTGTTAGAAGCCCATCCTTTGG - Intergenic
1102680281 12:114686277-114686299 GGTGTTATGAGCCAACACTCTGG - Intergenic
1106282101 13:28283844-28283866 GTGGTTAGGAGCACACACTCTGG - Intronic
1106657845 13:31766435-31766457 GGTGTTAGGAGTGAAAACACAGG + Intronic
1107163500 13:37259145-37259167 GGTGTCAGGAGTCCAGACTCAGG - Intergenic
1108239516 13:48447710-48447732 GTAGGTAGGAGCACAAACTCTGG - Intronic
1109888773 13:68579278-68579300 GAGGTTAGGAGCCTATACTCAGG + Intergenic
1110812967 13:79830647-79830669 GCTGTCAGCAGCCCACACTCTGG - Intergenic
1111942135 13:94621476-94621498 GCTGATAGGAGCTCAAATTCAGG - Intronic
1118819245 14:69334341-69334363 TGGGATCGGAGCCCAAACTCTGG + Intronic
1121913228 14:97811474-97811496 GGTGTTGGGAACCAAATCTCTGG + Intergenic
1126113823 15:45190921-45190943 GCTTTTAGGAGCTCATACTCTGG - Intronic
1126665879 15:51076290-51076312 GAGCTTAGGAGCCCAACCTCAGG - Intronic
1127968819 15:63943511-63943533 GCGGTTAGGAGCACAAACTTTGG - Intronic
1128195220 15:65747525-65747547 TGTGTTCAGAGCACAAACTCTGG - Intronic
1129773419 15:78217397-78217419 CTTGTTAGGAGCATAAACTCTGG - Intronic
1130089802 15:80811183-80811205 TGGTTTAGGAGCCCAAAGTCGGG + Intronic
1134747040 16:16596434-16596456 GTTTTTAGGAGCCCACATTCTGG + Intergenic
1134998436 16:18757226-18757248 GTTTTTAGGAGCCCACATTCTGG - Intergenic
1135043669 16:19136809-19136831 GTGGTTAGGAGCTCAAGCTCTGG + Intronic
1137974584 16:53020549-53020571 TGTGTCAGGGGCCCATACTCAGG - Intergenic
1139654530 16:68379261-68379283 GATGCTGGGAGCACAAACTCTGG + Intronic
1140912148 16:79463932-79463954 AGTGTTAGGAGACAAAACCCTGG + Intergenic
1143043544 17:4057905-4057927 GGCGTTAAGAGCACAGACTCCGG - Intronic
1143974485 17:10820021-10820043 GGTGCTAGGAGCACAGGCTCAGG + Intergenic
1145109430 17:20149209-20149231 GTTGTTAAGAACACAAACTCTGG + Intronic
1147224719 17:38967659-38967681 GGTTCCTGGAGCCCAAACTCAGG + Intergenic
1151545712 17:74791661-74791683 GGCGCTAGGAGCCCACACCCAGG + Intronic
1158800523 18:60903098-60903120 GGTGTAATGAGCCCAAACATAGG + Intergenic
1167685959 19:50956723-50956745 GTGGTTAGGAGCCCAAACTGTGG + Intergenic
925015920 2:524001-524023 GATGTTAGGACCCCGACCTCAGG + Intergenic
926945106 2:18178863-18178885 TGTCTTAGGGGCCCAAACACAGG - Intronic
927485723 2:23487303-23487325 GGTGTTTGGAGGCCAAACCAAGG + Intronic
932926872 2:75986702-75986724 GGTGTTAGGAGCCCTGACAAGGG + Intergenic
936998640 2:118441229-118441251 GGTGTTAAGAGCTAAAACTTGGG - Intergenic
937932371 2:127217228-127217250 GATGTTAAGAGCACAGACTCTGG + Intronic
938341686 2:130540303-130540325 GATGTTAGAAGCCCAGACCCAGG + Intronic
938348143 2:130580406-130580428 GATGTTAGAAGCCCAGACCCAGG - Intronic
941690278 2:168494303-168494325 GTGGTTAAGAGCCCGAACTCTGG + Intronic
941741214 2:169037387-169037409 GAGGTTTGGTGCCCAAACTCAGG - Intergenic
943132154 2:183867365-183867387 GGACTTAGGAGCCCACACTGAGG + Intergenic
943788941 2:191910002-191910024 GTAGTTAGGAGCCCAGACTTTGG + Intergenic
946365914 2:219248941-219248963 GGTGCAAGGGGCCCAAAGTCAGG + Exonic
946441753 2:219702967-219702989 GGGGATAGGAGCTCAAAGTCAGG - Intergenic
947910055 2:233794845-233794867 GAGGTCAGGAGTCCAAACTCAGG + Intronic
1169065888 20:2693869-2693891 GGCGGAAGGAGCCCTAACTCTGG + Intronic
1170870750 20:20203868-20203890 GGTGACACGAGCCCAAACTCAGG + Intronic
1175480671 20:59308492-59308514 GGGGTTAAGAGCTCAAACTGTGG + Intronic
1175939317 20:62530669-62530691 GGTGTGAGGAACCCAGCCTCTGG - Intergenic
1180649457 22:17366783-17366805 TCTGGTTGGAGCCCAAACTCGGG + Intronic
1184155481 22:42663999-42664021 GGTTTTCTGAGCACAAACTCTGG + Intergenic
950714482 3:14838019-14838041 GGTCTCAGGAGGCCAAAGTCAGG + Intronic
951857622 3:27215125-27215147 GGTGTTAAGAGCCGAAACTATGG - Intronic
955043470 3:55338232-55338254 GGTGGTAGAAGCCATAACTCTGG - Intergenic
960576573 3:119235768-119235790 GCTGTTAGGAGCTTAATCTCTGG - Intronic
961919625 3:130412379-130412401 GTGGTTAGCAGCCCAGACTCTGG - Intronic
964199194 3:154098875-154098897 GGTGATAGAAGCCCAAAACCAGG - Intergenic
964274338 3:154992823-154992845 GGTATTAAGAGCCCTCACTCAGG + Intergenic
964695580 3:159504152-159504174 GATGATAGGAGCCCAAACACAGG + Intronic
964740619 3:159961493-159961515 GATGTTAAGAACCCAAGCTCTGG + Intergenic
969961511 4:10949036-10949058 GGTGTTAAGAGCAGAAACTGAGG + Intergenic
972183352 4:36496979-36497001 GGTGTCTGGAGCAGAAACTCAGG + Intergenic
977937422 4:102823230-102823252 GTTGTTAAGAGCACATACTCTGG + Intronic
979259464 4:118634125-118634147 GTTGTTGGGAGGCCAAAGTCGGG - Intergenic
980785167 4:137543728-137543750 AATGTTAGGAGACCAAACACAGG - Intergenic
981208717 4:142075265-142075287 TGTGTCAGGAGCCCCACCTCTGG - Intronic
981313246 4:143316951-143316973 GGTATTTGGAACCCAGACTCAGG - Intergenic
983875430 4:172869562-172869584 GTGGTTAGGAGCCCAGACTTGGG - Intronic
986208492 5:5648281-5648303 GGTATTAAGAGCACAAACTGTGG + Intergenic
986494509 5:8329057-8329079 AGAGGTAGAAGCCCAAACTCAGG - Intergenic
988702067 5:33685416-33685438 GGTGTTAGTTGTCCCAACTCAGG - Intronic
990609053 5:57439689-57439711 ATGGTTAGGAGGCCAAACTCTGG + Intergenic
991457773 5:66822860-66822882 GGTGTTAGGAGCCCAAACTCTGG + Intronic
995933573 5:117481944-117481966 GTGGTTAGGAGCAGAAACTCTGG - Intergenic
1003903149 6:10673961-10673983 GTTGTTAGCAGCCCAAACTAAGG - Intronic
1004134313 6:12951695-12951717 GGTGCTAGGAGGCCAGGCTCAGG - Intronic
1004808201 6:19227385-19227407 GGTGTGAAGATCCCAGACTCTGG - Intergenic
1006741614 6:36312967-36312989 GGTGGCAGGAGCCCAAGTTCTGG + Intergenic
1007155177 6:39735935-39735957 GCTGTCAGGAGCCCAAAGTGAGG - Intergenic
1013488233 6:110618549-110618571 GGTGTTAGGAGCCTGGACACAGG + Intronic
1022960662 7:35423361-35423383 GATGTTAGGACCGCAAACTGGGG - Intergenic
1027240571 7:76325305-76325327 GGTGTGGGCAGACCAAACTCAGG + Intergenic
1029061044 7:97798204-97798226 GTGGTTAGGAGCCCCAACCCTGG + Intergenic
1031136869 7:117894114-117894136 TGAGTTAGGAACCCAAACTTTGG - Intergenic
1031486439 7:122331855-122331877 GGAGTTATGAGCACAGACTCTGG - Intronic
1034063883 7:148118432-148118454 TGAGGTTGGAGCCCAAACTCAGG - Intronic
1037365677 8:18119473-18119495 GGTGTTAGTAATCTAAACTCTGG - Intergenic
1041105787 8:54442758-54442780 GGTGGCAGAAGCCCAAACTAAGG - Intergenic
1041521291 8:58759162-58759184 GGTCTTTGGAGCTCCAACTCTGG - Intergenic
1042904146 8:73756322-73756344 GCTGTGAGGGGGCCAAACTCAGG - Intronic
1047348003 8:124047213-124047235 GTGGTTAGGAGCACAAACTTTGG + Intronic
1047477922 8:125252841-125252863 GGAGTTAAGAGCGCAAGCTCCGG + Intronic
1048064429 8:130952957-130952979 GGTGTTAGGAACCCACTTTCAGG - Intronic
1049272370 8:141702752-141702774 GGTGTGAGGAGCACAAAGTGTGG - Intergenic
1051840724 9:21394699-21394721 AGTATTAGAAGCCCAAACTCTGG + Intergenic
1052767779 9:32659406-32659428 TGTGTTAGGAATCCAAATTCAGG + Intergenic
1053601438 9:39614119-39614141 GTTGTTAATACCCCAAACTCTGG + Intergenic
1053859087 9:42367900-42367922 GTTGTTAATACCCCAAACTCTGG + Intergenic
1054252096 9:62728319-62728341 GTTGTTAATACCCCAAACTCTGG - Intergenic
1054566211 9:66762820-66762842 GTTGTTAATACCCCAAACTCTGG - Intergenic
1058164698 9:101606354-101606376 GGTAGGAGGAGACCAAACTCAGG + Intronic
1058554786 9:106155570-106155592 GGAGTAAAGAGCCCAAACTTGGG - Intergenic
1058900790 9:109440510-109440532 GGTGGTAGGAGCACTAACTGGGG - Intronic
1189899677 X:45693238-45693260 GGAGTTAGGAGAGGAAACTCTGG - Intergenic
1192154077 X:68730581-68730603 GGAGTTAGGAGCACACACTCTGG - Intergenic
1192593698 X:72384302-72384324 GGTGTTTGGAGGCCAAGCTGTGG - Intronic
1195399981 X:104451057-104451079 TATTTTAGGAGCACAAACTCTGG - Intergenic
1196032770 X:111108974-111108996 GGTGTTAGGAGCACCAACTCTGG + Intronic
1198034924 X:132792387-132792409 GGAGTTAGGAGCCAAAACTAAGG + Intronic
1198158315 X:133984361-133984383 GGCGTTAGGAGCCCAACCGCTGG + Intronic
1198554300 X:137776461-137776483 GAGGTTAAGAGCACAAACTCTGG + Intergenic
1199305647 X:146264645-146264667 GCTATTAAGAGCCCAGACTCTGG - Intergenic