ID: 991458200

View in Genome Browser
Species Human (GRCh38)
Location 5:66827420-66827442
Sequence GATATATGCAAAGACCGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991458194_991458200 30 Left 991458194 5:66827367-66827389 CCCTTCTCTGCTGGGGTGGCATT 0: 1
1: 0
2: 0
3: 22
4: 210
Right 991458200 5:66827420-66827442 GATATATGCAAAGACCGTTTGGG 0: 1
1: 0
2: 1
3: 2
4: 91
991458198_991458200 -5 Left 991458198 5:66827402-66827424 CCTCTTTGTATGTCTGGAGATAT 0: 1
1: 0
2: 0
3: 23
4: 258
Right 991458200 5:66827420-66827442 GATATATGCAAAGACCGTTTGGG 0: 1
1: 0
2: 1
3: 2
4: 91
991458195_991458200 29 Left 991458195 5:66827368-66827390 CCTTCTCTGCTGGGGTGGCATTT 0: 1
1: 0
2: 0
3: 16
4: 257
Right 991458200 5:66827420-66827442 GATATATGCAAAGACCGTTTGGG 0: 1
1: 0
2: 1
3: 2
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991458200 Original CRISPR GATATATGCAAAGACCGTTT GGG Intronic
907076783 1:51586406-51586428 GATATATCCATAGAATGTTTGGG - Intronic
908289391 1:62647724-62647746 GATATACCCAAAGAACATTTTGG - Exonic
909950465 1:81713768-81713790 GAAATATGCAAAGACCCTGAGGG + Intronic
911718911 1:101168413-101168435 GAAAAATGCAAAGTCTGTTTTGG - Intergenic
917933575 1:179841778-179841800 GATATATGCAAATGCAGTGTTGG + Exonic
919460952 1:197876134-197876156 AATATATGCAATGATTGTTTTGG + Intergenic
920591623 1:207224455-207224477 GAAATATGCAAAGAGCACTTTGG - Intergenic
1066808949 10:39299278-39299300 GATATTTGGAAACACCCTTTTGG - Intergenic
1069501736 10:68958874-68958896 AATTTATACAAAGACAGTTTAGG - Intronic
1073374802 10:103023959-103023981 GAAGTATGCAAAAACAGTTTAGG - Intronic
1076504806 10:130964549-130964571 GATATATTCACAGACACTTTGGG + Intergenic
1077598800 11:3557956-3557978 GAAAAATGCAAAGAGGGTTTGGG - Intergenic
1080947334 11:36988791-36988813 GATATATGCAAAACCCCTTGAGG - Intergenic
1082580971 11:54868403-54868425 GAAATATGGAAACACAGTTTTGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1085913469 11:80856426-80856448 AATATATGGAAAGACTCTTTAGG - Intergenic
1094768810 12:33629094-33629116 GATAGATGTAAAGACTGATTTGG + Intergenic
1097610552 12:61814652-61814674 AATATCTGCAAAGTCCCTTTTGG - Intronic
1099752289 12:86791318-86791340 GATATATCCAAACACCATCTTGG + Intronic
1100725304 12:97402175-97402197 GATATTTGGAAAGGCTGTTTGGG - Intergenic
1102726556 12:115070711-115070733 CATGTTTGCAAAGACCCTTTTGG + Intergenic
1108846934 13:54690018-54690040 GATAAATGCAAATGCAGTTTAGG - Intergenic
1109099232 13:58159373-58159395 TAAATATGCAAACACCTTTTAGG + Intergenic
1111643206 13:90996811-90996833 AACATCTGCAAAGACCCTTTTGG - Intergenic
1112453890 13:99539852-99539874 GATATATTCAGAAACCATTTGGG + Intronic
1121912134 14:97801427-97801449 GCTATGTGCAAAGACAGTGTTGG + Intergenic
1124270577 15:28276792-28276814 GATACATGCAATGACCCCTTTGG + Intronic
1125429277 15:39580046-39580068 GAAAAATGAAAAGAACGTTTAGG + Intergenic
1126555424 15:49982615-49982637 GAAATATGAAAAGACCAGTTAGG + Intronic
1130845499 15:87740421-87740443 GAAAGATGCTAAGACCATTTGGG + Intergenic
1130891819 15:88139894-88139916 CATATAGGCAAAGACCATGTTGG + Intronic
1148922623 17:51052493-51052515 GATCTATGAAAAGAGCTTTTGGG + Intronic
1149704810 17:58685514-58685536 GACATATGCAAACACTGTTGAGG + Intronic
1154039016 18:10835225-10835247 GAGAGCTGCAAAGACTGTTTGGG - Intronic
1155899477 18:31370637-31370659 GATATATCCAAAGATTCTTTTGG - Intergenic
1158793499 18:60812284-60812306 TATTTATGCAAAGACAGTATCGG + Intergenic
1159957119 18:74526510-74526532 GATGAATGCAAAGACCCTTGAGG - Intergenic
1163594903 19:18215379-18215401 GATCTGTGCAAAGACAGTTCCGG - Intronic
929265367 2:39913110-39913132 GATCTATGCAGAGACCTTGTAGG + Intergenic
929629815 2:43447869-43447891 GATATATGCAAAGACCAGAGTGG - Intronic
941545073 2:166839954-166839976 GATGTATGCGAAGATAGTTTGGG - Intergenic
941607980 2:167623710-167623732 GATATATGCACAGAACGTGCAGG - Intergenic
943451139 2:188043822-188043844 GATATATGTACAGAATGTTTAGG - Intergenic
1169337386 20:4767564-4767586 TATATATATAAAGACCGTTGGGG + Intergenic
1172920370 20:38476286-38476308 GACATGTGCAAAGACTTTTTGGG + Intronic
1174955488 20:55093309-55093331 GAGATACGCAATGACCTTTTTGG - Intergenic
1178036366 21:28587910-28587932 GATATATGCAGAGAGCATTTTGG + Intergenic
1182245087 22:28950948-28950970 GATACATTCATAGACTGTTTTGG - Intronic
950751658 3:15133897-15133919 GAAAAATGCAAAGAGGGTTTGGG + Intergenic
951668534 3:25154553-25154575 GAGATATGCAAAGGCCACTTTGG - Intergenic
955636462 3:61035455-61035477 GATATATGCAAAGTAAATTTTGG - Intronic
962462664 3:135628922-135628944 AATATATGCAAAGAGCACTTTGG - Intergenic
963864976 3:150350825-150350847 GAGATTTGCAGAGACCATTTGGG + Intergenic
967291939 3:187929738-187929760 GATAGATGCAAACACAATTTGGG + Intergenic
969740564 4:9022854-9022876 GAAAAATGCAAAGAGGGTTTGGG + Intergenic
969799908 4:9555683-9555705 GAAAAATGCAAAGAGGGTTTGGG + Intergenic
970623821 4:17855434-17855456 GATAGATGCAAACAGGGTTTCGG - Intronic
971073634 4:23124011-23124033 TATATATGCATAGACAGCTTAGG - Intergenic
971201016 4:24509229-24509251 CATATCTGCAAAGTCCTTTTTGG + Intergenic
971928494 4:33047194-33047216 AATATATTCAAAGTCCATTTGGG - Intergenic
979470869 4:121094137-121094159 GCTAAATCCAATGACCGTTTTGG - Intergenic
979535248 4:121812293-121812315 AATATATTAAAAGACCATTTAGG - Intronic
981108541 4:140908670-140908692 GTTTTATGCAAAAACAGTTTAGG + Intronic
982554827 4:156847109-156847131 AATATATGCATATACCCTTTAGG + Intronic
982603133 4:157477514-157477536 TATATATGCAAAGAACATCTGGG + Intergenic
983215117 4:164995569-164995591 TGTATATGCATAGACCATTTGGG + Intergenic
985129781 4:186727444-186727466 GATAAATGCAAACACTGTTGAGG + Intergenic
986932044 5:12837405-12837427 GATATATGAAAACTCTGTTTGGG - Intergenic
987588678 5:19893380-19893402 GATATATGCAAACGCTATTTGGG - Intronic
987646727 5:20682311-20682333 TGTATATGCAAACACTGTTTTGG + Intergenic
988449915 5:31331238-31331260 AACATTTGCAAAGACCGTTCTGG + Intergenic
991458200 5:66827420-66827442 GATATATGCAAAGACCGTTTGGG + Intronic
992555568 5:77899521-77899543 AATAAAGGCAAAGACCGTTGAGG - Intergenic
994163689 5:96585072-96585094 GATATATGCACATACTGTTATGG + Intronic
995950047 5:117700964-117700986 GAGATATGCAAAGCCCATTAGGG + Intergenic
998321066 5:141232177-141232199 CTTACATGCAAAGACCATTTAGG - Intergenic
1002153757 5:177258447-177258469 CCTATATGCACAGACAGTTTTGG - Intronic
1010065916 6:71682245-71682267 GATATATGGAGAGTCCTTTTGGG + Intergenic
1015029216 6:128574161-128574183 GGTATATGCAAAAGCCGTTAAGG + Intergenic
1017928705 6:158933698-158933720 AATATATGCATCGACTGTTTTGG + Intergenic
1021886100 7:25141164-25141186 GATATCTGCAGAGAACGTATTGG + Intronic
1024992714 7:55248786-55248808 GGAAAATGCAAAGACCATTTAGG - Intronic
1032996983 7:137457961-137457983 GATATATGCATAGAGTGTTCTGG - Intronic
1044303175 8:90608642-90608664 AATTTTTGCAAAGGCCGTTTTGG - Intergenic
1049117713 8:140703905-140703927 GATATTTGGAAATACGGTTTTGG - Intronic
1052063159 9:23985830-23985852 GATATAGGCAAAGACTGTTTGGG - Intergenic
1056019105 9:82423153-82423175 GATTTATGCAAAGAAGGATTGGG + Intergenic
1057317771 9:93980934-93980956 GATACATGCAAATACCTTATCGG - Intergenic
1058041012 9:100302035-100302057 GATATATGAAAATAATGTTTGGG - Intergenic
1187777530 X:22779052-22779074 TATATATGCAAAGACTTATTTGG + Intergenic
1188538230 X:31220671-31220693 GAAATATACAAACAACGTTTAGG - Intronic
1189936250 X:46071854-46071876 CATATATGCAAACACCATTTAGG - Intergenic
1191871461 X:65749356-65749378 GATTTTAGCAAAGACCCTTTGGG - Intergenic
1194261584 X:91702281-91702303 GATATATGTAAAAATAGTTTGGG - Intergenic
1199787628 X:151118992-151119014 CATATGTGCAAAGTCCTTTTTGG - Intergenic