ID: 991460917

View in Genome Browser
Species Human (GRCh38)
Location 5:66857417-66857439
Sequence ATGCCAAGAAGCAGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2688
Summary {0: 1, 1: 2, 2: 74, 3: 461, 4: 2150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991460914_991460917 26 Left 991460914 5:66857368-66857390 CCATGTGTGGATTGCTTGCTGTC 0: 1
1: 0
2: 0
3: 12
4: 160
Right 991460917 5:66857417-66857439 ATGCCAAGAAGCAGAATTGCTGG 0: 1
1: 2
2: 74
3: 461
4: 2150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991460917 Original CRISPR ATGCCAAGAAGCAGAATTGC TGG Intronic
Too many off-targets to display for this crispr