ID: 991461434

View in Genome Browser
Species Human (GRCh38)
Location 5:66863451-66863473
Sequence TCTGGAGGTCAGACCGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991461434 Original CRISPR TCTGGAGGTCAGACCGAAGC CGG (reversed) Intronic
901459332 1:9382388-9382410 TCAGGCGTTCAGACCGCAGCCGG + Intergenic
903065758 1:20698363-20698385 CCGGGAGGTGAGACCCAAGCGGG - Exonic
903356426 1:22750863-22750885 TCTGGAGGTGTGACCCAGGCAGG - Intronic
908179747 1:61592003-61592025 TCTGGAGGTGAGAGTGAAGATGG - Intergenic
913221427 1:116663813-116663835 TCTGAAAGTGAGACCGATGCAGG - Intronic
914506704 1:148295875-148295897 TCTGCAGGTCCAACCGAAACAGG - Intergenic
914942363 1:152034534-152034556 TCTGGAGGTCACTCCAAACCAGG + Intronic
914980455 1:152410372-152410394 TCTGGAACTCAGACCCAGGCAGG - Exonic
1067700865 10:48570931-48570953 TCTGGAGGTCTGGCCAGAGCAGG - Intronic
1069179995 10:65346916-65346938 TGTGGATGTCACACAGAAGCAGG - Intergenic
1071600117 10:86954910-86954932 ACTGGAGGTCACACAGGAGCAGG - Intronic
1073452440 10:103617811-103617833 TCTGAAGGTCAGACAGAGGAAGG - Intronic
1074772549 10:116742987-116743009 CCTGGGGGACAGACAGAAGCTGG - Intergenic
1075787845 10:125061984-125062006 GGTGGAGGTGGGACCGAAGCCGG + Intronic
1076278504 10:129225444-129225466 TCTGGATTTCAGACCCAAGATGG + Intergenic
1077511074 11:2963436-2963458 TCTGGAGGGCAGCCCCCAGCTGG + Intronic
1077635482 11:3839088-3839110 TCTGGAGGAAAGACTGCAGCTGG - Intronic
1077881415 11:6353646-6353668 CCTGCAGGTCAGGCCGAAGGAGG + Intergenic
1080163229 11:29204539-29204561 AGTGGAGGTAAGACTGAAGCAGG + Intergenic
1083181554 11:60989031-60989053 CCTGGAGGTGGGACAGAAGCTGG - Intronic
1083988569 11:66232831-66232853 TCTGCAGTTCAGACCGAAGCTGG - Intronic
1084543086 11:69799325-69799347 GCTGGAGGTCAGACTGCTGCTGG - Intergenic
1087695377 11:101370071-101370093 CACAGAGGTCAGACCGAAGCAGG - Intergenic
1088152212 11:106758477-106758499 TATGGAGGGCGAACCGAAGCAGG - Intronic
1088202253 11:107351038-107351060 TCTGGCTTTCAGACCAAAGCTGG - Intronic
1088824823 11:113484573-113484595 TCTGGAGGCTAGGCCCAAGCTGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1094142030 12:27191275-27191297 TCAGGAGGTCAGAACAAAACTGG + Intergenic
1095958242 12:47818843-47818865 TGGGGAGGTCAGACCCAAACGGG + Intronic
1095986964 12:48005151-48005173 TCTGGAGCACAGGCCGAAGTTGG + Intergenic
1096771911 12:53940471-53940493 TCTGGAGTCCAGACCCAGGCTGG + Intronic
1097282479 12:57853191-57853213 TCTTGAGGCCAGAACGAAGCTGG - Intergenic
1099479030 12:83143076-83143098 TCTGGAGGCCAGGTAGAAGCAGG - Intergenic
1103639049 12:122333691-122333713 TGTTGAGAACAGACCGAAGCCGG + Intronic
1104753225 12:131252959-131252981 TCTGGAGGTTGGAACGCAGCTGG + Intergenic
1107113082 13:36718679-36718701 GCTGGAGGTCATATCGAAGATGG - Intergenic
1107442602 13:40441451-40441473 TCTGGAGGTCAGACCAGGGCAGG + Intergenic
1116111857 14:40595156-40595178 TCTGGAGGTCAGAGCTAATTTGG - Intergenic
1116126560 14:40796073-40796095 TCTGGAGGTTAGAGCTAAGGTGG + Intergenic
1116883468 14:50195293-50195315 TCTGTTGGTCAGACCAAATCTGG + Intronic
1117033874 14:51706335-51706357 TGTGGAGTAAAGACCGAAGCAGG - Intronic
1117591624 14:57275218-57275240 TCTGAAGGTCTGACTGAGGCTGG + Intronic
1121073265 14:91044498-91044520 CCTAGAGGTCAGACAGAAGGGGG + Intronic
1121780333 14:96618022-96618044 TCTGGAGGTGTGACTGCAGCAGG + Intergenic
1122549652 14:102543185-102543207 TTTGGAGGTTAGACAGAAGAGGG + Intergenic
1125176631 15:36830058-36830080 TCTGGAGGTCAGAGGGAAGGGGG + Intergenic
1128919144 15:71594500-71594522 TCTGGAGCTCAGGCAGAGGCTGG - Intronic
1129466514 15:75727248-75727270 CCTGGAGGCCAGACTGTAGCAGG - Exonic
1131046518 15:89319849-89319871 TCTGCAGGTTAGATGGAAGCTGG - Intronic
1131340889 15:91599537-91599559 TCTGGAGAGCAGACGGAAGGTGG + Intergenic
1134616857 16:15658183-15658205 GCTGGAGGTAAGCCTGAAGCCGG - Intronic
1134862409 16:17572355-17572377 TCTGGAGGCCAGACTTAGGCTGG - Intergenic
1135200328 16:20431652-20431674 TCTGAAGGTCAAACTGCAGCCGG + Intronic
1135218359 16:20591947-20591969 TCTGAAGGTCAAACTGCAGCCGG - Intergenic
1135877934 16:26221700-26221722 TTTGGAAGTCAGACAGAACCTGG - Intergenic
1139699024 16:68695806-68695828 TCTGGAGGCCAGGCCGGAGGTGG + Exonic
1139948846 16:70659620-70659642 TGTGGAGGTCAGCCCCAAGGTGG + Exonic
1142526457 17:545220-545242 TCTGCAGGCCAGGCCGAAGAAGG - Intronic
1142698013 17:1644129-1644151 TCTGTAGGTCAGAGCGGAGCAGG - Intronic
1142794323 17:2295727-2295749 TCTGGAGGTCAGGAGAAAGCTGG - Intronic
1144718164 17:17448890-17448912 TGTGGAGGTCAGTGCGAAGCTGG - Intergenic
1154304225 18:13218528-13218550 ACTGGAGGTCAGCGGGAAGCGGG + Intronic
1155041812 18:22071138-22071160 CCTGGAGGTGAGGCCGGAGCAGG - Intergenic
1155586073 18:27366925-27366947 TCTCAAGGGCAGACCCAAGCAGG + Intergenic
1156009742 18:32482951-32482973 TCAGTAGGTCAGACCAAATCAGG + Intergenic
1160849281 19:1182343-1182365 TCTGGTAGTCAGACTGAGGCCGG + Intronic
1160941219 19:1621317-1621339 TCAGGGGGTCAGACAGAAACCGG - Intronic
1164596971 19:29536635-29536657 TCTGGGGGACGGACTGAAGCAGG - Intronic
1166320783 19:42017690-42017712 CCTGGAGGTAAGACAGAGGCTGG + Intronic
925069659 2:956338-956360 TCTGCAGCTCAGTCCGGAGCAGG + Intronic
929548769 2:42875704-42875726 TCCGGAGGAAAGACCGGAGCTGG - Intergenic
935645094 2:105328490-105328512 TCTGTTGGTCAGCCGGAAGCTGG - Intronic
935870417 2:107442141-107442163 ACTGGAAATCAGACTGAAGCTGG - Intergenic
937335871 2:121062118-121062140 TCTGGAGGTCAGAGGGAGGTGGG + Intergenic
937919156 2:127118187-127118209 ACTGGGGGTCAGAGCTAAGCAGG - Intergenic
945619709 2:212119732-212119754 ACTGGAGGTCAGAAGAAAGCTGG + Intronic
947149671 2:227102354-227102376 CATGGAGGCCAGACCGCAGCTGG - Intronic
948735733 2:240003793-240003815 GGTGGAGGACAGACCCAAGCAGG + Intronic
948980247 2:241490858-241490880 CCTGGAGGTCAGGCTGATGCAGG + Intronic
1172386976 20:34540876-34540898 ACTGAAGGTCAGAAGGAAGCTGG - Exonic
1172713479 20:36945666-36945688 TCTGGAGTTCTGACCTAAGGTGG - Intronic
1173569691 20:44068253-44068275 CATGGAGGTCAGACCCCAGCAGG + Intronic
1174360812 20:50027952-50027974 GCTGGATGTCAGGCCAAAGCTGG + Intergenic
1175917580 20:62433880-62433902 TTTGGAGGGCAGGCCGGAGCAGG + Intergenic
1176185478 20:63776050-63776072 TCTGTAGCTCAGGCAGAAGCTGG - Intronic
1179477443 21:41656751-41656773 TCTGGGGCACAGACCAAAGCTGG + Intergenic
1181815584 22:25434198-25434220 TCTGGGGGTCAGACCAACTCAGG - Intergenic
1185270098 22:49925803-49925825 TCTGAAGCTCAGACCTCAGCGGG + Intronic
1185294883 22:50048247-50048269 CCTGGAGGACAGACAGAAGCAGG - Intronic
949876507 3:8629377-8629399 CCTAGAGGTCAGAGCCAAGCAGG + Intronic
951823168 3:26836784-26836806 ACTGGAGGTCAGAACAAGGCTGG + Intergenic
952684399 3:36132110-36132132 TCTGGAGGTCACACTGAGGAAGG + Intergenic
956221980 3:66914189-66914211 TATGGAGGTCAGAAGGCAGCAGG + Intergenic
962005324 3:131343721-131343743 TCTGGAGCTCTGGCCTAAGCTGG + Intronic
965773094 3:172201295-172201317 TCTGGAGAGCAGCCAGAAGCAGG - Intronic
966116516 3:176469827-176469849 TCTGCAGGTCAGACCCCGGCAGG - Intergenic
968623762 4:1616737-1616759 TCCGCGGGACAGACCGAAGCAGG - Intergenic
976899945 4:90160264-90160286 TCTGGAGGTCAGGGCTAAACTGG + Intronic
987390150 5:17367964-17367986 CCTGGAACTGAGACCGAAGCTGG - Intergenic
991461434 5:66863451-66863473 TCTGGAGGTCAGACCGAAGCCGG - Intronic
994641289 5:102412512-102412534 TTTGGAGGTGAGACCAAGGCAGG + Intronic
997449674 5:133971727-133971749 TCTGCAGGTCAAAGCGAGGCAGG - Intergenic
1002087313 5:176784348-176784370 TCAGGAGGTCAGACCTCAGATGG - Intergenic
1006098671 6:31672051-31672073 TCTGGGAGTCAGACAGAGGCAGG - Exonic
1009491609 6:64299446-64299468 TCTGTGGGTCAGACCCCAGCAGG + Intronic
1013596458 6:111664940-111664962 TCTGCAGGTCAGCCCGTTGCAGG - Intronic
1013602699 6:111719911-111719933 GATGGAGGTCACACCGAAGCTGG + Exonic
1018091034 6:160347561-160347583 CCTGGCGTTCAGACCGAAGGTGG + Intergenic
1023357210 7:39379229-39379251 TCTGGAGGTTAGGCCCAAGTTGG + Intronic
1031714724 7:125094722-125094744 TCAGGGGATCAGACTGAAGCTGG - Intergenic
1032191202 7:129766966-129766988 TTTGGAGGTCAGAGCCAGGCAGG + Intergenic
1033755865 7:144398189-144398211 TCTGGAGGGTAGACTGAGGCAGG - Intronic
1035476911 7:159150091-159150113 CCTGGAGTTCAGAGAGAAGCAGG + Intergenic
1036178723 8:6565112-6565134 GCTGGAGGTCACACAGAAGCAGG - Intronic
1036802989 8:11806721-11806743 TCTGGAGCTCAGTCCAGAGCGGG + Intronic
1045052612 8:98340772-98340794 TCTGGAGGACAGACCCATGGAGG + Intergenic
1049267227 8:141674720-141674742 TCCTGAGGTCAGACCAAAGGAGG - Intergenic
1055001874 9:71460325-71460347 TTTGGAGGTCAGACAAAATCTGG + Intergenic
1059228132 9:112692162-112692184 CCTGGAAGTCAGACTGCAGCGGG + Intronic
1061006110 9:127929297-127929319 TCTGGAGCTCAGGCTGAGGCAGG - Intronic
1061902050 9:133678021-133678043 TCTGGAGGTCAGACCCTTCCAGG + Intronic
1062555351 9:137111292-137111314 TCTGGGGGTGAGACGGGAGCAGG + Intronic
1062555369 9:137111349-137111371 TCTGGGGGTGAGACGGGAGCAGG + Intronic
1189102655 X:38207352-38207374 TGAGGAGGTCAGCCCAAAGCAGG + Intronic
1189463615 X:41261974-41261996 TCAGGAGGTCAGGGGGAAGCAGG - Intergenic
1190115226 X:47621940-47621962 CCTGGAGGTGGGACTGAAGCTGG - Intergenic
1190917167 X:54819622-54819644 ACAGGAGATCAGACCGGAGCAGG - Intergenic
1192138565 X:68629628-68629650 TCTGGAGCACAGGCCGAACCAGG + Intergenic
1192874300 X:75211593-75211615 TCTGGAGGTCAGCCCAGGGCTGG + Intergenic
1196442362 X:115728441-115728463 TCTGGAGGTCCGAGAGAAGCAGG - Intergenic
1196443195 X:115732463-115732485 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196443853 X:115735431-115735453 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196445516 X:115844378-115844400 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196446187 X:115847359-115847381 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196446858 X:115850340-115850362 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196447526 X:115853323-115853345 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196448197 X:115856302-115856324 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196448866 X:115859293-115859315 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196449537 X:115862284-115862306 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196450206 X:115865267-115865289 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196450876 X:115868252-115868274 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196451547 X:115871231-115871253 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196452218 X:115874218-115874240 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196452888 X:115877187-115877209 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196453558 X:115880180-115880202 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196454227 X:115883189-115883211 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196455308 X:115888261-115888283 TCTGGAGGTCCGAGAGAAGCAGG + Intergenic
1196456154 X:115892957-115892979 TCTGGAGGCCTGACAGAAGTGGG - Intergenic
1196463766 X:115952952-115952974 TCTGGAGGCCTGACAGAAGCAGG - Intergenic