ID: 991466432

View in Genome Browser
Species Human (GRCh38)
Location 5:66917622-66917644
Sequence TTAACTAGGACTTAAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991466432_991466434 1 Left 991466432 5:66917622-66917644 CCAGTTACTTAAGTCCTAGTTAA 0: 1
1: 0
2: 0
3: 10
4: 151
Right 991466434 5:66917646-66917668 ACAAGAAAATTTATTTTTCATGG No data
991466432_991466435 2 Left 991466432 5:66917622-66917644 CCAGTTACTTAAGTCCTAGTTAA 0: 1
1: 0
2: 0
3: 10
4: 151
Right 991466435 5:66917647-66917669 CAAGAAAATTTATTTTTCATGGG 0: 1
1: 0
2: 2
3: 86
4: 965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991466432 Original CRISPR TTAACTAGGACTTAAGTAAC TGG (reversed) Intronic
908041029 1:60113364-60113386 TTAACTAGGACATAAACATCAGG + Intergenic
908078578 1:60548488-60548510 TTAATGAGAACTTCAGTAACTGG + Intergenic
911660726 1:100498688-100498710 TTAACTAGGACCCAAGAAACTGG - Intronic
912593681 1:110852811-110852833 TTATCTAGGACTGCAGTAAATGG - Intergenic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915682341 1:157593519-157593541 ATAACTAGGCCTCAAGTAAGAGG - Intronic
921577744 1:216856796-216856818 TTAACTGGGTCTTAAGAGACTGG - Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1064537429 10:16372108-16372130 TTAAATAGGATTTAAGTCAATGG + Intergenic
1065658260 10:27976590-27976612 TTAACTAAGACCTAAATAAATGG + Intronic
1066576461 10:36831192-36831214 TTAACAAAGACTTAAGAAAATGG + Intergenic
1068164754 10:53314724-53314746 TTAACTGAGACTTAAGTATATGG - Intergenic
1070361438 10:75693641-75693663 TTAACTGGGACTGAAGTATCTGG + Intronic
1070458258 10:76639757-76639779 TCAACTTGGATTTAAGTGACTGG - Intergenic
1071314078 10:84374886-84374908 TTAACAATGGCTTAAGTAAAAGG - Intronic
1072175173 10:92913435-92913457 GGAACTTGGACTTAAGTAAAAGG - Intronic
1072527988 10:96291174-96291196 TTAACTAGGTTTTAAATAAGTGG + Intergenic
1075239248 10:120763103-120763125 GTAATTAGGACTTGAGAAACTGG + Intergenic
1075934777 10:126330909-126330931 TTCACTGGGACTTAAATAAATGG - Intronic
1076208565 10:128622953-128622975 TAAACTAGGACTCAAGCAAGGGG + Intergenic
1080563332 11:33484508-33484530 TTACACAGGAATTAAGTAACTGG - Intergenic
1080738354 11:35039641-35039663 TTTTCTAGGAATCAAGTAACTGG - Intergenic
1083127736 11:60589025-60589047 ATAACAATGACTTCAGTAACTGG - Intergenic
1085568377 11:77536962-77536984 TTAAATAAGACATAAGTAAATGG + Intronic
1086583497 11:88425753-88425775 TTAAGTAGGAATTCAGAAACTGG - Intergenic
1087360890 11:97158278-97158300 TTAACTAGGCCAAAGGTAACGGG - Intergenic
1087581655 11:100063190-100063212 TTACCTATGAATTAAGTAGCTGG - Intronic
1088162570 11:106890454-106890476 TTGACTAGAACTTAAGTTTCAGG - Intronic
1088523151 11:110721231-110721253 TTAAGTAGGATTTAAGGAAAAGG - Intergenic
1088723751 11:112616969-112616991 TTAAGAAGGGCTTAAGTAATGGG + Intergenic
1088951760 11:114578814-114578836 TGAACTAGGATTTTAGCAACTGG + Intronic
1090133962 11:124176307-124176329 TTAACTAGGACATAACCAATTGG + Intergenic
1095364992 12:41392598-41392620 ATAACTAGGATGTAAGTAAGGGG - Intronic
1095663385 12:44764904-44764926 TTAGCAAGGACTTAGCTAACAGG - Intronic
1096588126 12:52637166-52637188 TTAACTATGACAAAAGTGACAGG + Intergenic
1096855558 12:54479652-54479674 ATATCTAGGACATGAGTAACAGG + Intergenic
1098619408 12:72575330-72575352 TCAACTATGACCTAAGGAACTGG + Exonic
1102129460 12:110514723-110514745 TGATCTAGGGCATAAGTAACTGG + Intronic
1102845046 12:116171593-116171615 TTAAGAAGGACTTAAAAAACTGG - Intronic
1108326924 13:49342681-49342703 TAAACTAGGACTTAGGGAAGGGG - Intronic
1109010169 13:56930503-56930525 TTAACTATGACTTGAAGAACTGG + Intergenic
1109174245 13:59135751-59135773 TTAACTGGGACAAAAATAACAGG - Intergenic
1110860951 13:80343602-80343624 TTATCTTGAACTTAAGTTACAGG - Intergenic
1115685361 14:35790999-35791021 TTATCAAGGACTTCAGTACCTGG - Intronic
1116367411 14:44084547-44084569 TTAACTAGGCCCAAAGTGACAGG + Intergenic
1116617483 14:47156532-47156554 TTAACTGCGACTGAAGTCACAGG + Intronic
1117464062 14:55974783-55974805 TTAACGTGGCCTTAATTAACTGG - Intergenic
1120737301 14:88067073-88067095 ATTACTAGGACCTAAGTTACTGG - Intergenic
1128865766 15:71114584-71114606 TGAATTAGGACTCAAGAAACGGG + Intronic
1131657952 15:94481519-94481541 TTAACTAGGCATAATGTAACTGG - Exonic
1131940063 15:97552676-97552698 TGCACTAGTACTTAAGTAAAAGG - Intergenic
1133910792 16:10064435-10064457 TCAACTAGGACTTTATCAACGGG + Intronic
1139976181 16:70812706-70812728 TTAAAAAGGACTTAAATAAGTGG + Intronic
1143133018 17:4692528-4692550 TTAACTAGAAAATAAGTACCTGG - Intronic
1146714724 17:35075869-35075891 TTAACTGTGAGTTAAGTTACAGG + Intronic
1148428621 17:47623390-47623412 TAAATTAGGAATTAAGGAACTGG - Intergenic
1152810403 17:82379124-82379146 TTAAATAAAACCTAAGTAACAGG + Intergenic
1154025421 18:10703205-10703227 TTACCTAGGGCTGAAGTAAGAGG - Intronic
1155666580 18:28316387-28316409 TTAACTAGGCCATAGGTTACAGG + Intergenic
1155691085 18:28623457-28623479 TTAAAGAGGACTTAAATAAATGG + Intergenic
1156063139 18:33105701-33105723 CAAACTAGGATTTAAGGAACTGG - Intronic
1156919492 18:42503681-42503703 ATAACAACAACTTAAGTAACAGG - Intergenic
1157369039 18:47093273-47093295 TTAACTAGTACTTAACTAAGTGG - Intronic
1159264277 18:66059595-66059617 TTAAAGAAGACTTAAGTAAATGG + Intergenic
1167539705 19:50077519-50077541 TTTGCTAGGACTGATGTAACAGG + Intergenic
925145052 2:1575757-1575779 TCACCTAGGACTTAGGCAACAGG + Intergenic
929752733 2:44733193-44733215 TTAAATAAGACCTAAGTAAATGG - Intronic
930263313 2:49171620-49171642 TTAATTTGGACTGATGTAACAGG - Intergenic
931473362 2:62562789-62562811 GTAACTAGGAATTAGGTAATAGG + Intergenic
932387549 2:71350352-71350374 TTAACTAGGCGTTAAGGAAATGG + Intronic
933416278 2:81990513-81990535 TTTACTAGGATTTAGGTCACTGG - Intergenic
935021674 2:99238135-99238157 TCCATTAGGACTTAATTAACAGG - Intronic
936048435 2:109204260-109204282 TTATCTAGGAATGAAGCAACAGG - Intronic
942913018 2:181269155-181269177 TTAAATAATACTTAAATAACTGG + Intergenic
943056237 2:182984105-182984127 ATAAATAGAACTTAAGTATCTGG + Intronic
944611843 2:201418039-201418061 TTAAAGAGGACCTAAGTAAATGG + Intronic
945393172 2:209289151-209289173 ATAAATAAGACTTAAGTAAATGG - Intergenic
1170175653 20:13466424-13466446 TTAAAGAGGACTTACATAACTGG - Intronic
1171403948 20:24897265-24897287 TTATCAAGGACTTACATAACGGG - Intergenic
1171747889 20:29017029-29017051 CTAAAAAGGACTTAAATAACTGG + Intergenic
1174034346 20:47658688-47658710 TTTAATAGGACATTAGTAACAGG - Intronic
1174716503 20:52764913-52764935 TTAATTTGGGCTGAAGTAACAGG + Intergenic
1176237133 20:64058571-64058593 TCAACTAGGACTCCAGGAACTGG - Intronic
1176350545 21:5791845-5791867 CTAAAAAGGACTTAAATAACTGG - Intergenic
1176357359 21:5912429-5912451 CTAAAAAGGACTTAAATAACTGG - Intergenic
1176544866 21:8189915-8189937 CTAAAAAGGACTTAAATAACTGG - Intergenic
1176563817 21:8372960-8372982 CTAAAAAGGACTTAAATAACTGG - Intergenic
1177158208 21:17520145-17520167 TTAAGTATCACTTAATTAACAGG - Intronic
1182872477 22:33660622-33660644 TGAAATAGGACTCAAGAAACTGG - Intronic
1184752343 22:46494483-46494505 TTAAGAAGGACTTAAATAAATGG - Intronic
1203249736 22_KI270733v1_random:106153-106175 CTAAAAAGGACTTAAATAACTGG - Intergenic
953100130 3:39816544-39816566 ATAACTAAGACTTAAGTGCCAGG - Intronic
955954885 3:64278731-64278753 CTAACTAGGAGTTCAGTAACTGG - Intronic
958075589 3:88673068-88673090 TGAACTGGATCTTAAGTAACAGG + Intergenic
967517950 3:190392651-190392673 TAAACTAGGACTTGAAGAACAGG + Intronic
972880391 4:43416010-43416032 ATAACTAGTACTCAAGTAAGAGG - Intergenic
973646601 4:52956651-52956673 TTGTCTAGGACTTTACTAACTGG - Intronic
975202049 4:71602680-71602702 TTCTCTAGGACAGAAGTAACAGG + Intergenic
975268966 4:72406524-72406546 TCAAATAGGAATTAAGTAAATGG - Intronic
975361331 4:73475261-73475283 TTAACTATGGCTGGAGTAACTGG + Intergenic
975499650 4:75070649-75070671 TTAACTATGACTTAAGTTTATGG - Intergenic
976391937 4:84514606-84514628 TTAACTAAGATTCAATTAACAGG + Intergenic
976429733 4:84948506-84948528 TGATCTAGGATTTAAGTGACAGG - Intronic
976717650 4:88139622-88139644 TAAACTAGGAGTGAAATAACTGG - Intronic
977664888 4:99634931-99634953 TGAAATAGGTCTTAAGAAACTGG + Intergenic
980259038 4:130423982-130424004 TTAACTATGATTTTACTAACAGG - Intergenic
980351372 4:131689235-131689257 TTAATTAGGGCTCAAGTATCTGG + Intergenic
981845153 4:149159161-149159183 TTACCTAGGACAAATGTAACAGG - Intergenic
987692892 5:21291683-21291705 TTTATTAGGACTTACGTAAAGGG + Intergenic
988858463 5:35252406-35252428 GTAACTAGGAAATAACTAACTGG - Intergenic
989976280 5:50590832-50590854 TCAACTAGGACTTAAATATCTGG + Intergenic
991466432 5:66917622-66917644 TTAACTAGGACTTAAGTAACTGG - Intronic
991747407 5:69758043-69758065 TTTATTAGGACTTACGTAAAGGG - Intergenic
991750322 5:69797283-69797305 TTTATTAGGACTTACGTAAAGGG + Intergenic
991798985 5:70337899-70337921 TTTATTAGGACTTACGTAAAGGG - Intergenic
991801895 5:70377084-70377106 TTTATTAGGACTTACGTAAAGGG + Intergenic
991826758 5:70633261-70633283 TTTATTAGGACTTACGTAAAGGG - Intergenic
991829610 5:70672134-70672156 TTTATTAGGACTTACGTAAAGGG + Intergenic
991891343 5:71337326-71337348 TTTATTAGGACTTACGTAAAGGG - Intergenic
993074751 5:83214990-83215012 TTAAAGAAGACTTAAGTAAATGG + Intronic
993548040 5:89237769-89237791 TTAACAAATACATAAGTAACTGG - Intergenic
995015484 5:107304435-107304457 CTACCTAGGACTCAAATAACAGG + Intergenic
995374572 5:111459559-111459581 TTAACTTTGATTTAAGTAAGTGG - Intronic
995375077 5:111464763-111464785 TTAACTTTGATTTAAGTAAGTGG + Intronic
995630840 5:114130325-114130347 TCTACTAGTGCTTAAGTAACTGG - Intergenic
997142130 5:131393188-131393210 TTAACTTGGAATAAAGGAACAGG + Exonic
999536293 5:152521214-152521236 TTCACTAGGACTTAAGAAGGTGG + Intergenic
1001148197 5:169203205-169203227 TTATCTAGGACTAAAGTCAAGGG + Intronic
1001291459 5:170465740-170465762 TGAACTAGGACCTAAGAAATGGG + Intronic
1003191852 6:3881265-3881287 TTAACTTGGAGTTAAGCAAAAGG - Intergenic
1003830504 6:10005013-10005035 TTATCTATGACTTAGGAAACTGG + Intronic
1010122335 6:72391074-72391096 TTAACTTGGACTTTGGTGACAGG - Intronic
1010275255 6:73961675-73961697 ATAACTAGTCCTTAAGTAAGAGG - Intergenic
1013242932 6:108262188-108262210 TGAACTAGGACCTAATTAATTGG - Intergenic
1016209504 6:141511400-141511422 TGAACTAGGTCTTGAATAACAGG + Intergenic
1017361956 6:153583908-153583930 TTAACTAGGACTTTATAAATAGG + Intergenic
1017955384 6:159173380-159173402 TCAAAGAGGACTGAAGTAACAGG - Intronic
1018220994 6:161579324-161579346 TTAACTAGGCCTTATCTGACAGG - Intronic
1018373622 6:163191078-163191100 TTAACTTGAATCTAAGTAACAGG - Intronic
1019264470 7:105777-105799 TTGACAAGGACTTAAGAAACAGG + Intergenic
1023263438 7:38380804-38380826 TTTCCTAGGACTTCAGTAAATGG - Intergenic
1023603559 7:41905780-41905802 TTAAATATGTCTTAAGTAACAGG + Intergenic
1031440385 7:121787489-121787511 TTAACTAAGTCCTAAGTAACTGG - Intergenic
1031818125 7:126465479-126465501 TTAAAGAGGACTTAAGTAAATGG - Intronic
1032852640 7:135808468-135808490 TTAACAAGAACTTAAGTTTCTGG + Intergenic
1037357505 8:18037634-18037656 TTAAGTAGGACATCAGTGACTGG + Intergenic
1045777757 8:105825785-105825807 TTAACAAGGCCTTAAGTCACTGG + Intergenic
1046059604 8:109121513-109121535 TTAATTAGGAATTAGGTCACAGG - Intergenic
1046532752 8:115469321-115469343 TTAACTAGAACATCATTAACTGG + Intronic
1047172953 8:122511970-122511992 TTAAATGGGACTTAAATAAATGG - Intergenic
1048781603 8:138007749-138007771 GTATCTAGGAAGTAAGTAACTGG + Intergenic
1049137188 8:140913694-140913716 TTAAACAAGACTTAAATAACTGG + Intronic
1050268677 9:3918516-3918538 GGAACTAGGACTTAAACAACTGG + Intronic
1052634606 9:31085999-31086021 TTTATTAGGACTTAAATAAGAGG + Intergenic
1052790860 9:32874300-32874322 TTAACCAGGAATTAAAGAACTGG - Intergenic
1203466134 Un_GL000220v1:89415-89437 CTAAAAAGGACTTAAATAACTGG - Intergenic
1186085247 X:5982247-5982269 TTAATTAGGATTTATGTTACTGG - Intronic
1187706647 X:22015768-22015790 TTAACTAGGCCTGAATTCACAGG + Intergenic
1189704025 X:43742146-43742168 TTATCTAGGACATAAGAAATGGG - Intronic
1189950548 X:46226061-46226083 TTAACTAGGCCAAAGGTAACAGG - Intergenic
1199261341 X:145779014-145779036 GTGACTTGGAATTAAGTAACAGG + Intergenic
1199531557 X:148853643-148853665 TCAACTAGGAGTCAAGAAACAGG - Intronic