ID: 991467809

View in Genome Browser
Species Human (GRCh38)
Location 5:66932668-66932690
Sequence AATTAGCTATGCGTGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991467806_991467809 -7 Left 991467806 5:66932652-66932674 CCATATTGGGGTTGGTAATTAGC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 991467809 5:66932668-66932690 AATTAGCTATGCGTGGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991467809 Original CRISPR AATTAGCTATGCGTGGGTCA TGG Intronic
No off target data available for this crispr