ID: 991469657

View in Genome Browser
Species Human (GRCh38)
Location 5:66954544-66954566
Sequence GTCTTCCCCTATCAGAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991469657_991469658 2 Left 991469657 5:66954544-66954566 CCTACACTCTGATAGGGGAAGAC 0: 1
1: 0
2: 0
3: 16
4: 323
Right 991469658 5:66954569-66954591 ACAATAAATAAATATATGTTAGG 0: 1
1: 0
2: 11
3: 165
4: 1592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991469657 Original CRISPR GTCTTCCCCTATCAGAGTGT AGG (reversed) Intronic
905426522 1:37889663-37889685 CTCCTCCACTATCACAGTGTCGG - Exonic
906073869 1:43037440-43037462 GGCTTCCCCTCTCTGAGTCTTGG - Intergenic
908209173 1:61882118-61882140 GTCTGCCCCCACCAGAATGTGGG - Intronic
908311714 1:62890756-62890778 GAATTCCCCCATCTGAGTGTAGG - Intergenic
909221018 1:72961977-72961999 GTCTCCCACTATTAGTGTGTGGG + Intergenic
910312323 1:85838199-85838221 GTCTTCCCCCAACAAAATGTGGG - Intronic
910609299 1:89124033-89124055 GTCTTTCCCTATCAGTTCGTAGG + Intronic
911641676 1:100296377-100296399 GTCTTGGCCTCTCAGAGTGCTGG + Intergenic
911675116 1:100649668-100649690 GTCTTCCACTATTATTGTGTGGG - Intergenic
913021688 1:114794382-114794404 GCCTTGACCTCTCAGAGTGTTGG + Intergenic
914786962 1:150842242-150842264 GGCTTCCCCCATCAGAAAGTGGG - Intronic
915441709 1:155949627-155949649 GTCTTGGCCTCCCAGAGTGTCGG - Intronic
916036585 1:160927938-160927960 GCCTTGGCCTACCAGAGTGTTGG - Intergenic
916340988 1:163734774-163734796 GTCTTAGCCTCTCAAAGTGTTGG + Intergenic
918546562 1:185691135-185691157 GCCTTGGCCTCTCAGAGTGTTGG + Intergenic
918614555 1:186529767-186529789 GTCTTCCACTATTATTGTGTGGG + Intergenic
918943445 1:191029704-191029726 GTTTTCCACTATCATTGTGTAGG - Intergenic
919015517 1:192028665-192028687 GTCTCCCACTATCATTGTGTGGG + Intergenic
923363750 1:233238439-233238461 GCCTCCCCCTCTCAAAGTGTTGG - Intronic
924331960 1:242948692-242948714 GTCTTCCACTATGATCGTGTGGG - Intergenic
924781667 1:247154747-247154769 GCCTTGCCCTCTCAAAGTGTTGG - Intronic
924834284 1:247633302-247633324 GTCTCCCACTATTACAGTGTGGG + Intergenic
1065119123 10:22511836-22511858 GTCTTCCACTATTATTGTGTGGG + Intergenic
1065652652 10:27909566-27909588 GCCTTCGCCTCTCAAAGTGTTGG - Intronic
1066084752 10:31965299-31965321 GTCTTGGCCTCTCAAAGTGTTGG - Intergenic
1066509531 10:36081196-36081218 GTCTTCCACTATTATTGTGTGGG + Intergenic
1066513959 10:36134286-36134308 GTCTTTTCCTACCAAAGTGTGGG - Intergenic
1068062775 10:52090060-52090082 GCCTTGCCCTCTCAAAGTGTTGG + Intronic
1068551661 10:58414466-58414488 TTCTTCCACAATCAGAGTGGGGG - Intergenic
1069263345 10:66428287-66428309 GTCTTCCATTATCATTGTGTGGG - Intronic
1069333844 10:67325837-67325859 GTCTCCCCCTATTATATTGTGGG + Intronic
1069542457 10:69305492-69305514 GTCTCTCCCGATCAGAATGTGGG + Intronic
1070642150 10:78177857-78177879 GTCTTCCCCTCTCAAAGCGACGG - Intergenic
1070934139 10:80280476-80280498 GTCTCCCCCTCCTAGAGTGTTGG - Intronic
1071369035 10:84932367-84932389 GTCTCCCCATAGCAGAGTATAGG - Intergenic
1071818588 10:89256819-89256841 ATCTTCCCCTACCTGAGTGAAGG - Intronic
1072024522 10:91441669-91441691 GTCTCCCACTATCATTGTGTGGG + Intronic
1072025175 10:91447926-91447948 GTCTCCCACTATCATTGTGTGGG - Intronic
1073270623 10:102260407-102260429 GTCTTGGCCTCTCAAAGTGTTGG + Intronic
1073276183 10:102313527-102313549 ATCTTCACCTACCAGGGTGTGGG - Intronic
1075584875 10:123650504-123650526 AACTTGCCCCATCAGAGTGTTGG - Intergenic
1075957926 10:126540407-126540429 GTCTTGGCCTCTCAAAGTGTTGG - Intronic
1077696685 11:4399390-4399412 GTCTCCCACTATCATTGTGTGGG - Intergenic
1078158509 11:8819143-8819165 GTCTTGGCCTCTCAGATTGTTGG - Intronic
1078331236 11:10423706-10423728 GTCTCCCCCTATTATTGTGTGGG + Intronic
1078532910 11:12150800-12150822 GTCTTACCATAGCAGAGAGTTGG + Intronic
1078626205 11:12961134-12961156 GTGTTCTCTTATCAGAATGTAGG - Intergenic
1078782149 11:14449379-14449401 GTATTCCCTTATAAGAGGGTGGG - Intronic
1079580112 11:22053755-22053777 GTCTCCCACTATTACAGTGTGGG + Intergenic
1082699683 11:56412330-56412352 GCCTTGGCCTCTCAGAGTGTTGG + Intergenic
1083345485 11:61987514-61987536 GTCTCCCACTATCATTGTGTGGG - Intergenic
1084138750 11:67208827-67208849 GTCTTAGCCTCTCAAAGTGTTGG - Intronic
1084998466 11:73006753-73006775 GTCTTCCCTCATTAGAATGTAGG + Intronic
1087295857 11:96372777-96372799 TTCTTCCCTTATCATAGTGTGGG - Intronic
1089061756 11:115631587-115631609 CTCTTACCCTTTCAGAGTTTAGG - Intergenic
1089692749 11:120197075-120197097 GTTTTCCCCTATCAGAGAAATGG - Intergenic
1090795684 11:130133957-130133979 TTCTTCCGCTAACAGAGTGAAGG - Intronic
1091549918 12:1529897-1529919 CTCTTCCCCTCTCAGAGCCTCGG + Intronic
1091850206 12:3690766-3690788 GTCTTCCACTATTATAGTGTGGG + Intronic
1092098377 12:5862595-5862617 GTCAGACCCTATCAGAGGGTTGG - Intronic
1092798074 12:12133811-12133833 GTGTTTCCCTATCAGGGTGCTGG - Intronic
1093016011 12:14155468-14155490 GCCTTGGCCTCTCAGAGTGTTGG - Intergenic
1093760174 12:22900973-22900995 GTCTTCCTCCATCAATGTGTGGG + Intergenic
1095534582 12:43230122-43230144 GTCTTCCACTATTAATGTGTGGG - Intergenic
1097910449 12:64964328-64964350 GTCTTCCACTATTATTGTGTGGG + Intergenic
1098193356 12:67974618-67974640 GTCTCCCACTATCATTGTGTGGG + Intergenic
1098937044 12:76492028-76492050 GTCTTCCCCTTCCAGAATATAGG - Intronic
1100710044 12:97246107-97246129 GTCTTACCCTATCTGAGGTTTGG - Intergenic
1102266760 12:111492432-111492454 GCCTTGGCCTCTCAGAGTGTTGG - Intronic
1102380151 12:112458457-112458479 GTCTTGGCCTCTCAAAGTGTTGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1105202455 13:18191873-18191895 GTCTTGGCCTCTCAGAGTGCTGG - Intergenic
1108564874 13:51686012-51686034 TTGCTTCCCTATCAGAGTGTTGG - Intronic
1108714293 13:53063759-53063781 GGCTTCCCTTCTCAGTGTGTGGG + Intergenic
1109375045 13:61481679-61481701 GTCTCCCCCTATTATTGTGTGGG + Intergenic
1110305352 13:73980908-73980930 GTCTTGGCCTCTCAGAGTGCTGG - Intronic
1110463426 13:75773211-75773233 AGCTTCCCCCATCAGAATGTAGG - Intronic
1111696975 13:91637322-91637344 CTCTTCCCCTAAAAGAGTGAGGG + Intronic
1112785239 13:102944199-102944221 GTCTTCCCCTTTCTGAGTTTTGG - Intergenic
1113859778 13:113473752-113473774 TTCTTCCCACTTCAGAGTGTTGG - Intronic
1116028415 14:39540726-39540748 GTCTTTCACTATCATTGTGTGGG - Intergenic
1116417403 14:44695446-44695468 GTCTTCCACTATTATTGTGTGGG - Intergenic
1116554043 14:46280207-46280229 GTTTTCCACTATCACATTGTAGG - Intergenic
1116868716 14:50051992-50052014 CTCTTCTCCTTTCAGAGAGTGGG + Intergenic
1116872443 14:50081023-50081045 GTCTACCCCTACCATACTGTTGG - Intergenic
1116977716 14:51134009-51134031 GTCTCCCACTATCATTGTGTGGG - Intergenic
1117624708 14:57623346-57623368 GTCTTCCACTATTATTGTGTGGG - Intronic
1118634712 14:67737176-67737198 GTCTTGGCCTATCAAAGTGCTGG + Intronic
1119594667 14:75923813-75923835 GTCTTCCACTATTATTGTGTGGG + Intronic
1119840844 14:77791738-77791760 GGCTGCCCATTTCAGAGTGTGGG + Intergenic
1120300787 14:82703964-82703986 GTCTCCCACTATCACTGTGTGGG + Intergenic
1122314617 14:100818399-100818421 GACTTCCTGTCTCAGAGTGTGGG - Intergenic
1122443435 14:101750544-101750566 GTCTTCCCCCATTAGAATGTAGG + Intergenic
1123416210 15:20097472-20097494 TACTTCCCCTCTCTGAGTGTCGG - Intergenic
1123506586 15:20947026-20947048 GTCTTCCACTATTATTGTGTGGG + Intergenic
1123525550 15:21104577-21104599 TACTTCCCCTCTCTGAGTGTCGG - Intergenic
1123563813 15:21520771-21520793 GTCTTCCACTATTATTGTGTGGG + Intergenic
1123600067 15:21958055-21958077 GTCTTCCACTATTATTGTGTGGG + Intergenic
1125272568 15:37955629-37955651 GTCTTCCACTATTATTGTGTGGG - Intronic
1125438869 15:39679352-39679374 CTCTTCCCCTGTCAGTTTGTCGG - Intronic
1125935806 15:43634626-43634648 GCCTTCACCTCTCAAAGTGTTGG + Intronic
1125948573 15:43731083-43731105 GCCTTCACCTCTCAAAGTGTTGG + Intergenic
1126054748 15:44719566-44719588 TTTTTCTCCTAACAGAGTGTGGG - Intergenic
1126951950 15:53891470-53891492 GTCTCCCACTATCATTGTGTGGG + Intergenic
1127300136 15:57644713-57644735 ATCTTGGCCTCTCAGAGTGTTGG + Intronic
1128591468 15:68901496-68901518 GTCTTCGCCTCCCAGAGTGCTGG - Intronic
1129168984 15:73796507-73796529 GTCTTCCCCCATAAGGGTGACGG + Intergenic
1130527817 15:84722301-84722323 GTCTTGGCCTCTCAGAGTGCTGG + Intergenic
1131134831 15:89926339-89926361 ACCTTCACCTCTCAGAGTGTTGG - Intergenic
1202972172 15_KI270727v1_random:247866-247888 GTCTTCCACTATTATTGTGTGGG + Intergenic
1132504467 16:300447-300469 GTCTTGGCCTCTCAAAGTGTTGG + Intronic
1132904143 16:2273588-2273610 GTCTTCCCCTCTCCGAGTTCTGG + Intergenic
1133324058 16:4932665-4932687 GCCTTACCCTCTCAGAGTGCTGG + Intronic
1133756340 16:8765080-8765102 GCCTTTGCCTCTCAGAGTGTTGG - Intronic
1134054733 16:11162689-11162711 GTCTTCTCTTACCAGCGTGTTGG + Intronic
1134310720 16:13073038-13073060 GTCTTGGCCTTTCAGAGTGCTGG + Intronic
1134484042 16:14642924-14642946 GTCTTGGCCTATCAAAGTGCTGG - Intronic
1134623171 16:15705229-15705251 GTCTTAGCCTCTCAAAGTGTTGG + Intronic
1135652037 16:24214641-24214663 TTCTTCCCCTCTCATAGTGTGGG + Exonic
1137336181 16:47551820-47551842 GTCTTCCACTATTATTGTGTGGG + Intronic
1138706172 16:58917983-58918005 GTCTTCCACTATTATTGTGTGGG + Intergenic
1138739101 16:59287006-59287028 GTCTTGGCCTCTCAGAGTGCTGG + Intergenic
1140072734 16:71666264-71666286 GTCTTGGCCTCTCAAAGTGTTGG - Intronic
1140885923 16:79242588-79242610 GTCTCCCACTATTAGTGTGTGGG - Intergenic
1141360981 16:83394896-83394918 GTCTTGGCCTCCCAGAGTGTTGG - Intronic
1142826436 17:2514702-2514724 GCCTTCGCCTCTCAGAGTGCTGG - Intergenic
1143193839 17:5060186-5060208 GTCTTGACCTCTCAAAGTGTTGG + Intergenic
1144012804 17:11165763-11165785 GTCTCCCACTATCATTGTGTGGG - Intergenic
1144595639 17:16568420-16568442 GCCTTTCACTATCAGAGGGTTGG + Intronic
1146825682 17:36021168-36021190 GTCTTCCACTATTATTGTGTGGG + Intergenic
1149157112 17:53644997-53645019 GTCTTCAGCTATCATGGTGTTGG + Intergenic
1150693992 17:67388567-67388589 GTCTTGGCCTCTCAAAGTGTTGG + Intronic
1151743297 17:75998393-75998415 GTCTTGCCCTCCCAAAGTGTTGG + Intronic
1152435170 17:80272033-80272055 GTCTTGCCCTCTCAAAGTGCTGG - Intronic
1152972910 18:182580-182602 GTCTTTCTCTATTAGACTGTAGG - Intronic
1156357928 18:36358881-36358903 GTCTTAGCCTCTCAAAGTGTTGG + Intronic
1159076905 18:63690602-63690624 GTCTTCCACTATTATTGTGTGGG - Intronic
1159448172 18:68565944-68565966 GTCTTGGCCTCTCAAAGTGTTGG - Intergenic
1160058528 18:75509020-75509042 GTTTTCCCCTCTCACAGTTTGGG - Intergenic
1160212464 18:76893760-76893782 GCCTTGGCCTCTCAGAGTGTTGG + Intronic
1164197252 19:22980415-22980437 GTCTCCCACTATTATAGTGTGGG - Intronic
1164616344 19:29668948-29668970 GGCTTCCCCAGTCAGTGTGTGGG + Intronic
1166902003 19:46071769-46071791 GTCTTGGCCTCTCAAAGTGTTGG - Intronic
1167893822 19:52564702-52564724 GCCTTGGCCTCTCAGAGTGTTGG - Intronic
926541769 2:14189325-14189347 GTCTTCCACTGTGACAGTGTAGG + Intergenic
927258034 2:21057704-21057726 GTCTTCGCCTCCCAAAGTGTTGG + Intergenic
927710342 2:25321649-25321671 GTCTTGGCCTCTCAGAGTGCTGG - Intronic
928844502 2:35654208-35654230 GTCTTACCATATTAGAGTATGGG + Intergenic
929644123 2:43610358-43610380 GCCTTGCCCTCTCAAAGTGTTGG - Intergenic
929838234 2:45427884-45427906 GTCTTCCGCTATTATTGTGTGGG - Intronic
931448400 2:62346786-62346808 GTCTTTTGTTATCAGAGTGTTGG - Intergenic
932539899 2:72641006-72641028 GTCTTCCACTATTATTGTGTGGG - Intronic
934645295 2:96055787-96055809 GTCTTCCCCTGCCAGGGAGTTGG - Intergenic
934838700 2:97611876-97611898 GTCTTCCCCTGCCAGGGAGTTGG - Intergenic
935061586 2:99612858-99612880 GTCTTTCCCTGCCAGTGTGTGGG + Intronic
935065182 2:99641172-99641194 TCCTTCCCCTGTCAGAGAGTAGG + Intronic
936673955 2:114692686-114692708 GTCTTCCACTATTATTGTGTGGG + Intronic
937606826 2:123810337-123810359 GTCTTCCACTATTATTGTGTGGG - Intergenic
937679564 2:124629094-124629116 GTCTCCCACTATCATTGTGTGGG - Intronic
938224042 2:129600179-129600201 GTCTTCCACTATTATTGTGTGGG + Intergenic
938567862 2:132536674-132536696 GTCTTCCACTATTATCGTGTGGG + Intronic
938586360 2:132694585-132694607 GTTTTCCCCTAGCATATTGTGGG - Intronic
939365196 2:141221442-141221464 GTCTCCCACTATCATTGTGTGGG - Intronic
941252519 2:163184013-163184035 GTCTTCCCCAAAAAGAGTGGCGG - Intergenic
941677706 2:168361639-168361661 ATCTTGCCCTATCAGATTGTAGG + Intergenic
941880971 2:170480238-170480260 ATCTTCCCCTTTCTGATTGTGGG + Intronic
942559543 2:177205995-177206017 GTCTTCTGTTATAAGAGTGTTGG - Intergenic
942924335 2:181413661-181413683 GTCTTCCACTATTATTGTGTGGG - Intergenic
943296340 2:186144874-186144896 GTCTTCCACTATTATTGTGTGGG - Intergenic
944102764 2:196046341-196046363 GTCTTCCCTTATTTGAGGGTAGG - Intronic
944635452 2:201671785-201671807 GGCTTCCCCTATTATTGTGTGGG - Intronic
945224783 2:207522463-207522485 GTCTTCCCATGTCACAGAGTCGG - Intergenic
945708956 2:213272223-213272245 GTCTTCCCTTATTACAGTTTTGG + Intergenic
945845680 2:214941556-214941578 GTCTTCCCCTGTGATTGTGTGGG + Intronic
945907296 2:215609570-215609592 GTCATCCTCTTTCAGAGTGGAGG + Intergenic
946913276 2:224487640-224487662 GTCTCCCCCTATTATTGTGTGGG - Intronic
947276831 2:228401515-228401537 GTCTTCCCCTATTCTAGTGCTGG + Intergenic
947662154 2:231877721-231877743 GCCCTCCCCTATCAGAGTGGAGG + Intergenic
948022829 2:234750505-234750527 GTCTTGGCCTCTCAAAGTGTTGG - Intergenic
1170496841 20:16933156-16933178 GTCTTCCACTATTATTGTGTGGG - Intergenic
1170581432 20:17702327-17702349 ATCTTGCCCCATCAGAGTGAGGG - Intronic
1170680833 20:18523648-18523670 GTCTTGGCCTCTCAAAGTGTTGG + Intronic
1173916504 20:46712035-46712057 GTCTTCACCTCTCAGTGTGGTGG + Intronic
1174082321 20:47979320-47979342 GGCTGCCCCTCTCCGAGTGTGGG + Intergenic
1175003968 20:55662592-55662614 GTCTTCTCCCACTAGAGTGTGGG + Intergenic
1176715496 21:10346135-10346157 GTCTTGGCCTCTCAGAGTGCTGG + Intergenic
1177171403 21:17659869-17659891 GTCTCTCGCTATGAGAGTGTTGG - Intergenic
1177313465 21:19426687-19426709 GTCTTCCACTATCATTGTGTGGG - Intergenic
1177764017 21:25436007-25436029 GTCTTCCACTATTATTGTGTGGG - Intergenic
1177926793 21:27226946-27226968 GTCTTCCCCTTCCAGGGTCTAGG + Intergenic
1177956340 21:27604018-27604040 GTCTCCCACTATCATTGTGTGGG + Intergenic
1178803799 21:35821659-35821681 GTCTTCACCTTCCAAAGTGTTGG - Intronic
1180350948 22:11802615-11802637 GTCTTCCACTATTATTGTGTGGG - Intergenic
1180602853 22:17033818-17033840 GTCTTGGCCTCTCAGAGTGCTGG - Intergenic
1180934256 22:19614060-19614082 GTCTTGGCCTCTCAAAGTGTTGG - Intergenic
1181163109 22:20969089-20969111 GTCTCCCCCTAGCAGTGGGTGGG + Intronic
1181931682 22:26406798-26406820 GTCTTGGCCTCTCAAAGTGTTGG - Intergenic
1182543479 22:31058537-31058559 TACTTCCCCTCTCTGAGTGTCGG + Intergenic
1183821972 22:40353531-40353553 GTCTTGGCCTTTCAAAGTGTTGG + Intronic
1184150928 22:42637997-42638019 GCCTCCGCCTCTCAGAGTGTTGG - Intronic
950083939 3:10243280-10243302 GCCTTGGCCTATCAAAGTGTTGG + Exonic
951580496 3:24157778-24157800 GTCTTGGCCTCCCAGAGTGTTGG + Intronic
951764517 3:26182742-26182764 GTCTTTCCCTGTCTGTGTGTTGG + Intergenic
951832451 3:26945391-26945413 GTCTTCCACTATTATTGTGTGGG - Intergenic
953079822 3:39606240-39606262 GTCTCCCACTATCATTGTGTGGG + Intergenic
956243667 3:67156821-67156843 GTCTCCCACTATCATTGTGTGGG - Intergenic
956762054 3:72452179-72452201 GTCACCCCCGATCAGGGTGTGGG - Intergenic
957302661 3:78412439-78412461 GTCTTCAGCTATCAGTGTCTTGG - Intergenic
957695979 3:83638261-83638283 GTCTCCCACTATTATAGTGTGGG - Intergenic
957912535 3:86639434-86639456 GTCTTCCACTATTATTGTGTGGG - Intergenic
958106014 3:89074489-89074511 GTCTTCCACTATTATTGTGTGGG - Intergenic
958703065 3:97617815-97617837 GTCTTCCACTATTATTGTGTGGG - Intronic
959462966 3:106649734-106649756 GTCTTCCACTATTATTGTGTGGG - Intergenic
959935238 3:112022293-112022315 TTGTTCCCATATCAGAGTGTAGG - Intergenic
960477013 3:118142883-118142905 GTCTTCCACTATTATTGTGTGGG + Intergenic
960718168 3:120598301-120598323 GTCTCCGCCTCTCAGAGTGCTGG + Intronic
961225025 3:125236311-125236333 GCCTTGCCCTCACAGAGTGTTGG + Intronic
964262231 3:154852336-154852358 GGCTTCCCCAATAAGAGTTTAGG - Intergenic
964369080 3:155980859-155980881 GTCTTGGCCTCCCAGAGTGTTGG + Intergenic
965621687 3:170648748-170648770 GTCTTCCACTATTATTGTGTGGG + Intronic
966922116 3:184619280-184619302 CTCTTTTCCTCTCAGAGTGTGGG + Intronic
966968837 3:185023443-185023465 GTCTTGGCCTCCCAGAGTGTTGG - Intronic
968692384 4:1999675-1999697 GTCTCCCCCTATTATTGTGTGGG - Intronic
968786497 4:2625971-2625993 GTCTTCACCTCCCAGAGTGCTGG + Intronic
969779847 4:9391690-9391712 GCCTCCGCCTCTCAGAGTGTTGG + Intergenic
971414434 4:26411159-26411181 GTCTTGGCCTCTCAAAGTGTTGG - Intronic
971970204 4:33609607-33609629 GTCTTCCACTATTATTGTGTGGG - Intergenic
973278733 4:48337212-48337234 GTGGTCCCCTATCACACTGTTGG - Intergenic
973661186 4:53107760-53107782 GTCTTCCACTATGATTGTGTGGG - Intronic
974141874 4:57898344-57898366 GTCTCCCACTATTAGTGTGTGGG + Intergenic
974263705 4:59558070-59558092 GTCTTCCACTATTATTGTGTGGG + Intergenic
976685209 4:87806753-87806775 GCCTTGGCCTCTCAGAGTGTTGG - Intronic
977255073 4:94731633-94731655 GTCTTGGCCTTTCAAAGTGTTGG + Intergenic
978657096 4:111077099-111077121 GTCTCCCACTATCATTGTGTAGG - Intergenic
979012893 4:115393986-115394008 GTCTACCACTATCATTGTGTAGG + Intergenic
980136631 4:128864393-128864415 GTCTTGGCCTCCCAGAGTGTTGG + Intronic
980419244 4:132539643-132539665 CGCTTCCCCTACCAAAGTGTTGG - Intergenic
980583260 4:134782405-134782427 GTCTTCCACTATTATAGTGTGGG + Intergenic
980664283 4:135908547-135908569 GTCTTCCACTATCATTGTGTGGG + Intergenic
981116171 4:140993568-140993590 GTCTTCCCTGATCATAGTGAAGG + Intronic
981139189 4:141248688-141248710 GTCTTCTAATATCAGAATGTTGG + Intergenic
982437164 4:155392936-155392958 TTCTGCCCACATCAGAGTGTGGG + Intergenic
984493917 4:180470925-180470947 GTCTCCCACTATCATTGTGTTGG - Intergenic
984771254 4:183438093-183438115 GCCTTGGCCTCTCAGAGTGTTGG + Intergenic
986625333 5:9718536-9718558 GTCTTTGCCTCTCAAAGTGTTGG - Intergenic
987687847 5:21227806-21227828 GTCTCCCACTATCATTGTGTGGG - Intergenic
991469657 5:66954544-66954566 GTCTTCCCCTATCAGAGTGTAGG - Intronic
992383584 5:76263038-76263060 GTCTTCCACTATTATTGTGTGGG + Intronic
992830931 5:80592898-80592920 GTCTTGGCCTCTCAGAGTGCTGG + Intergenic
992976628 5:82127888-82127910 GTCTTCCACTATTATTGTGTGGG + Intronic
993420738 5:87698347-87698369 GTCTCCCACTATTAGTGTGTGGG + Intergenic
994004834 5:94825647-94825669 GTCTTCCACTATTATTGTGTGGG + Intronic
995475284 5:112541492-112541514 GTCTTCCACTATTATTGTGTGGG - Intergenic
996481980 5:123986223-123986245 GTCTCCCCCTATTATTGTGTGGG + Intergenic
997937893 5:138130537-138130559 GTCTTGGCCTCCCAGAGTGTTGG - Intronic
999029802 5:148278870-148278892 GTCTTCCACTATTATTGTGTGGG + Intronic
1000335877 5:160241095-160241117 GTCTAGCCCTCTCAAAGTGTTGG + Intergenic
1001372371 5:171218497-171218519 GTCTCCCACTATTAGTGTGTGGG + Intronic
1001725442 5:173893863-173893885 GTCTTCCCCTATCAGTTATTGGG - Intronic
1002119112 5:176987878-176987900 GTCTTGGCCTCTCAGAGTTTTGG - Intronic
1003034031 6:2627465-2627487 GTCTTCCTCCATCAGGTTGTAGG + Intronic
1003437363 6:6103977-6103999 GTCTTCCACTATTATTGTGTGGG + Intergenic
1003532570 6:6949990-6950012 GTCTTCCCCTACTAGACTGTGGG - Intergenic
1003614489 6:7642667-7642689 GCCTTCGCCTCTCAAAGTGTTGG + Intergenic
1004903891 6:20218618-20218640 GTCTTTCCCTGGCAGAGTGTAGG - Intergenic
1005532147 6:26718779-26718801 GCCTTCCCCTTGCAGAGTGCTGG + Intergenic
1005538648 6:26782886-26782908 GCCTTCCCCTTGCAGAGTGCTGG - Intergenic
1006252894 6:32805275-32805297 GTCTCCCACTATCATTGTGTGGG + Intergenic
1006499735 6:34450349-34450371 GTCTTGGCCTCTCAAAGTGTTGG - Intergenic
1006933782 6:37703487-37703509 GTCTTCCCCCATCAGACTACGGG - Intergenic
1008482937 6:52005624-52005646 CTCTTCCCCTCTCACAGAGTAGG - Intronic
1008512542 6:52290245-52290267 GCCTTGCCCTCTCAAAGTGTTGG - Intergenic
1009325112 6:62339313-62339335 ATCTACCCCTCTAAGAGTGTAGG - Intergenic
1010412036 6:75571465-75571487 GTCTCCCACTATCATTGTGTGGG - Intergenic
1010482974 6:76377096-76377118 GTCTTCCACTATCACTGTGTGGG + Intergenic
1011689164 6:89849854-89849876 GTCTTGGCCTCTCAAAGTGTTGG + Intronic
1011910677 6:92433519-92433541 GCCTTGGCCTTTCAGAGTGTTGG + Intergenic
1011916568 6:92512896-92512918 GTCTTCCACTATTATTGTGTGGG - Intergenic
1013545760 6:111155447-111155469 GTCTTTGCCTCTCAAAGTGTTGG + Intronic
1017299698 6:152842298-152842320 GTTTTACCCTATCAGAGTTAAGG - Intergenic
1021208120 7:17809504-17809526 GTCTTCCACTATTATTGTGTGGG - Intronic
1022400450 7:30031202-30031224 TTCTTCCCCCACCAGACTGTAGG - Intronic
1023754541 7:43404039-43404061 GTTTTCCCCTATGAGACTGTTGG - Intronic
1026367746 7:69666650-69666672 GCCTTCACCTCTCAAAGTGTTGG - Intronic
1028139418 7:87256724-87256746 GTCTTCCACTATTATTGTGTGGG - Intergenic
1028537931 7:91910096-91910118 GCCTTGTCCTCTCAGAGTGTTGG + Intergenic
1029001870 7:97162997-97163019 GTCTCCCACTATCATTGTGTGGG + Intronic
1029817283 7:103109123-103109145 GTCTTCCACTATTATTGTGTGGG - Intronic
1032777069 7:135124430-135124452 GTCTTCCACTATTATTGTGTGGG - Intronic
1033403340 7:141048182-141048204 GTCTTGGCCTCTCAAAGTGTTGG + Intergenic
1033532190 7:142275504-142275526 GTATCCCACTATCATAGTGTAGG - Intergenic
1033825612 7:145186440-145186462 GTCTCAACCTGTCAGAGTGTTGG - Intergenic
1035632025 8:1115294-1115316 GTCTTCCACTATTATTGTGTGGG + Intergenic
1035968350 8:4220198-4220220 GCCTTCGCCTCTCAGAGTGCCGG + Intronic
1036344063 8:7944719-7944741 GTCTCCGCCTCTCAAAGTGTTGG - Intronic
1037588597 8:20294969-20294991 ATCTCCCCCAAGCAGAGTGTGGG + Intronic
1038019022 8:23537371-23537393 CTCTTCCCTCATCAGAATGTAGG + Intronic
1038713485 8:29971142-29971164 GTCTTCCCCATTCTGAGGGTAGG + Intergenic
1039465889 8:37784686-37784708 CTCTTCCCCTCCCAGGGTGTAGG + Intronic
1041854766 8:62438810-62438832 GTCTTGGCCTCCCAGAGTGTTGG + Intronic
1042759895 8:72259386-72259408 GTCTCCCACTATTATAGTGTGGG - Intergenic
1042977024 8:74480635-74480657 GTCTTCCTCTATCTATGTGTTGG + Intronic
1044103154 8:88166818-88166840 GTCTTGGCCTCTCACAGTGTTGG + Intronic
1044393078 8:91675980-91676002 GTGTTACCCTCTAAGAGTGTGGG - Intergenic
1045192783 8:99899125-99899147 GCCTTGGCCTACCAGAGTGTTGG - Intergenic
1045933281 8:107651819-107651841 GTCTTCCATTATCATTGTGTGGG + Intergenic
1046342218 8:112874509-112874531 GTCTTCCACTATTATTGTGTGGG + Intronic
1046648398 8:116810409-116810431 GTCTTGGCCTCCCAGAGTGTTGG + Intronic
1050159571 9:2703325-2703347 GTCTTACCCTCCCAAAGTGTCGG - Intergenic
1050787259 9:9420493-9420515 GTATTCCCCGATTACAGTGTAGG - Intronic
1051372407 9:16369868-16369890 GTGTTCCCCCATCAGTGTGCTGG + Intergenic
1056379525 9:86044700-86044722 GTCTTCGCCTCTCAAAGTGCTGG - Intronic
1057137371 9:92702410-92702432 GTCTTGGCCTCTCAAAGTGTTGG - Intergenic
1057906876 9:98990235-98990257 GTCTTCCCCTATCTGGGCCTTGG - Intronic
1058182771 9:101818060-101818082 GTCTTCCACTATTATTGTGTGGG - Intergenic
1058315227 9:103556511-103556533 GTCTCCCACTATCATTGTGTAGG - Intergenic
1059596540 9:115726367-115726389 GTCTTCCACTATTATTGTGTGGG - Intergenic
1059929532 9:119247401-119247423 GTCTTGGCCTCCCAGAGTGTTGG - Intronic
1186431194 X:9505839-9505861 GTCTCCCCCTATTATTGTGTGGG - Intronic
1187605437 X:20877111-20877133 GTCTTCCACTATTATTGTGTGGG - Intergenic
1190683180 X:52847091-52847113 GTCTTCCATTATCATTGTGTGGG + Intergenic
1191099396 X:56709350-56709372 GTCTTCCACTATTATTGTGTGGG + Intergenic
1191832098 X:65427067-65427089 GTCTTCCACTATTATTGTGTGGG + Intronic
1191933630 X:66402574-66402596 GTCTTCCACTATTACTGTGTGGG + Intergenic
1192686250 X:73308307-73308329 GTCTTCCACTATTACTGTGTGGG - Intergenic
1193057544 X:77169173-77169195 GTCTTTCCCTCTCACAGTTTGGG + Intergenic
1193082791 X:77422326-77422348 GTGTTCTCCCATCAGAATGTGGG - Intergenic
1193217205 X:78877410-78877432 GTCTTCCACTATTATTGTGTGGG - Intergenic
1193284378 X:79694888-79694910 GTCTTCCACTATTATTGTGTGGG + Intergenic
1193496217 X:82216796-82216818 GTCTTCCACTATTATTGTGTAGG + Intergenic
1193533398 X:82684433-82684455 GTCTTCCACTATTATTGTGTGGG + Intergenic
1193780561 X:85696799-85696821 GTCTTCCACTATTATTGTGTGGG + Intergenic
1194483778 X:94461556-94461578 GCCTTACCCTCTCAAAGTGTTGG - Intergenic
1194491922 X:94561201-94561223 GTCTCCCCCTCTCACACTGTGGG + Intergenic
1195213962 X:102678370-102678392 GTCTTCCACTATTATTGTGTGGG + Intergenic
1195832630 X:109076404-109076426 GTCTTCCTCTATTATTGTGTGGG + Intergenic
1197076599 X:122361346-122361368 GTCTTCCGCTATTACTGTGTGGG + Intergenic
1198090425 X:133323227-133323249 GTCTTGGCCTCTCAGAGTGCTGG - Intronic
1199537003 X:148914025-148914047 GTCTTTCCCTACCAGTGTGTGGG - Intronic
1201229298 Y:11847858-11847880 GTCTTCCACTATAATCGTGTGGG - Intergenic