ID: 991474270

View in Genome Browser
Species Human (GRCh38)
Location 5:67003473-67003495
Sequence GAGGATAAAGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2725
Summary {0: 2, 1: 2, 2: 51, 3: 289, 4: 2381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991474270_991474277 19 Left 991474270 5:67003473-67003495 CCCTCTTCCTTCTCTTTATCCTC 0: 2
1: 2
2: 51
3: 289
4: 2381
Right 991474277 5:67003515-67003537 TGTTCCTGGTATTTACTGCATGG 0: 1
1: 0
2: 1
3: 15
4: 137
991474270_991474276 5 Left 991474270 5:67003473-67003495 CCCTCTTCCTTCTCTTTATCCTC 0: 2
1: 2
2: 51
3: 289
4: 2381
Right 991474276 5:67003501-67003523 TTTGTAAGCGAGTTTGTTCCTGG 0: 1
1: 0
2: 2
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991474270 Original CRISPR GAGGATAAAGAGAAGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr