ID: 991476663

View in Genome Browser
Species Human (GRCh38)
Location 5:67028552-67028574
Sequence GAAGGGAGACGCTCAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991476658_991476663 5 Left 991476658 5:67028524-67028546 CCACAAGCAGGCTGGTGACCGTG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 991476663 5:67028552-67028574 GAAGGGAGACGCTCAGGAAGTGG 0: 1
1: 0
2: 1
3: 37
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991476663 Original CRISPR GAAGGGAGACGCTCAGGAAG TGG Intronic
900373182 1:2341327-2341349 GCAGGGTGATGCCCAGGAAGGGG - Intronic
900847021 1:5112299-5112321 GGAGGGAGAGGCAGAGGAAGAGG + Intergenic
901170202 1:7251407-7251429 AAAGGGAGACGGGCAGGATGGGG + Intronic
902038291 1:13473496-13473518 GAAGGGAGGAGGTCAGGAGGCGG + Intergenic
902117747 1:14136059-14136081 GAAAGGAGACCCTGGGGAAGAGG + Intergenic
902539393 1:17142480-17142502 GAAGGGAGACTCAAAGGAGGAGG + Intergenic
902951144 1:19883432-19883454 GAAGGAAAAGGGTCAGGAAGAGG + Intronic
903712517 1:25337077-25337099 GAAGGGAGAGATCCAGGAAGTGG - Intronic
903815391 1:26060845-26060867 GAGGTGAGAGGCACAGGAAGAGG + Intronic
903827218 1:26155115-26155137 GAAGGGAAGGGCTCAGGGAGGGG - Intergenic
903858618 1:26352030-26352052 GAAGGGAGAGGCTGAGGAGGGGG + Intronic
904260150 1:29283459-29283481 GAAGGCAGGGCCTCAGGAAGGGG - Intronic
904500801 1:30911744-30911766 GAAGGGAGACCCTGAGTATGTGG - Intergenic
904842258 1:33379948-33379970 GATGGCAGATGCTCAGGGAGGGG - Intronic
905202035 1:36322150-36322172 GAAGGGAGCCTCTCAGGGGGTGG + Exonic
905909311 1:41642965-41642987 GAAGGTGGAGGCTGAGGAAGAGG - Intronic
906074635 1:43042967-43042989 GAAGGGGGAGGAACAGGAAGAGG - Intergenic
907384706 1:54118483-54118505 GACGGGAAAAGCTAAGGAAGGGG - Intergenic
907856919 1:58312669-58312691 GAAGGGACAAGCTCAGTATGTGG + Intronic
908411344 1:63868725-63868747 GAAGTGAGAGGATCAGCAAGGGG + Intronic
909535267 1:76728634-76728656 GGAGGGAGATGCTGAGGAGGAGG - Intergenic
913955208 1:143284242-143284264 TAAGAGATATGCTCAGGAAGAGG - Intergenic
913982229 1:143531202-143531224 TAAGAGATATGCTCAGGAAGAGG + Intergenic
915892418 1:159784085-159784107 GAGGGGAGAGGTTCAGGAAGTGG - Intergenic
918081604 1:181211981-181212003 GAATGGACACACTCAGGGAGGGG - Intergenic
918495001 1:185125585-185125607 GAAGGGAGAGGGTGATGAAGAGG + Intronic
919997144 1:202762852-202762874 GGAGGGAGATGATGAGGAAGTGG - Intronic
921221450 1:212976852-212976874 GAAGGAAGACCTGCAGGAAGAGG + Intronic
921221722 1:212978418-212978440 GAAGGAAGACCTGCAGGAAGAGG + Intronic
923051278 1:230392943-230392965 GGAGGGAGAGGCACAGGAAGGGG + Intronic
924760081 1:246976087-246976109 TGAGGGAGACGCTGAGGGAGAGG + Intronic
1062925861 10:1314983-1315005 GAAGGGTGATGATCAGGAAGGGG - Intronic
1063377071 10:5560861-5560883 GCAGGGAGACCCTCCGGGAGGGG + Intergenic
1063499191 10:6537870-6537892 GAAGGGGGGCGCTGTGGAAGAGG - Intronic
1064712354 10:18140507-18140529 GAAGCGAGCCGCTCGGGAGGCGG - Intergenic
1065025193 10:21534398-21534420 GAGGGAAGACGCTGAGGAGGAGG + Exonic
1065382200 10:25101832-25101854 GAAGGGAGATGCAGAGGAAAAGG + Intergenic
1065455412 10:25901841-25901863 GAAGGGAGTGGGTAAGGAAGGGG - Intergenic
1067471371 10:46541127-46541149 GAAGGGTGGGGCTCAGGCAGGGG - Intergenic
1068823181 10:61402028-61402050 GAAAGGAGAATCTCTGGAAGGGG + Intergenic
1068830384 10:61487568-61487590 GAAGTGAGTTGCTCAGGAAAAGG - Intergenic
1069751010 10:70744945-70744967 GAAGTGAGACGGAGAGGAAGAGG + Intronic
1069869081 10:71522299-71522321 GAAGGGAGAGGGACAGGGAGGGG - Intronic
1069911086 10:71760408-71760430 GGAGGAAGAGGTTCAGGAAGGGG - Intronic
1072566125 10:96618061-96618083 AAGGGGAGATGCTCAGGAAGTGG + Intronic
1073049740 10:100659922-100659944 GGAAGGAGAGGCTCAGGGAGTGG + Intergenic
1073583562 10:104688323-104688345 GAAGGGAGCTGCCCAGGCAGAGG + Intronic
1073635339 10:105192439-105192461 GAAAGAAGAAACTCAGGAAGGGG + Intronic
1074572446 10:114636272-114636294 GCAGGGAGAGGCTCAAGATGAGG + Intronic
1074850196 10:117433213-117433235 CAAGGGAGACTCTTAGGAACTGG + Intergenic
1075070787 10:119318745-119318767 GAAGGGAGAAGCTGAGGATGGGG - Intronic
1075541648 10:123318773-123318795 AAAGGAAGACTCTCTGGAAGAGG + Intergenic
1075693677 10:124418539-124418561 GCAGGGAGAGGCTGAGGATGTGG - Intronic
1076266042 10:129110620-129110642 GCAGGCAGAGGCTCTGGAAGTGG + Intergenic
1080408813 11:32004236-32004258 GGAGGGAGAGGCAGAGGAAGAGG - Intronic
1083421027 11:62553376-62553398 GGAGGGAGGGGCTGAGGAAGCGG + Intronic
1083970659 11:66071983-66072005 GAGGGGAGACAGTCAGGAAGGGG - Intronic
1084128086 11:67114279-67114301 GGAGGGAGATGTTCAGGAAATGG + Intergenic
1084304229 11:68271504-68271526 GAATGGGGACACTCTGGAAGGGG - Intronic
1084972581 11:72780017-72780039 GAAGGGAGAAGGCAAGGAAGAGG + Intronic
1085126767 11:74007313-74007335 GGAGGGAGAGGGTCAGGAGGAGG - Intronic
1085196672 11:74676814-74676836 GAAGGGAGAGGCTGAGAAAGAGG - Intergenic
1087892085 11:103547128-103547150 GAGGTGAGACGGTCAGGCAGAGG + Intergenic
1089668084 11:120032963-120032985 GGAGGGGGAGGGTCAGGAAGCGG - Intergenic
1090640050 11:128722341-128722363 GAAGGGAGAAGGGCAGGAGGAGG + Intronic
1090659199 11:128869992-128870014 GAAGGCAGACGGGCAGAAAGAGG - Intergenic
1090833334 11:130435627-130435649 GAAGAGAGACCCTGAGGATGAGG - Intergenic
1090930584 11:131294891-131294913 GAAGGGAGACCCTCAGATATGGG + Intergenic
1091755153 12:3046432-3046454 AAAGGGAGAGGTTCAGGCAGGGG + Intergenic
1091834731 12:3577449-3577471 GAACAGGGACGCTCAGGAAGGGG - Intronic
1091834747 12:3577532-3577554 AAACAGGGACGCTCAGGAAGGGG - Intronic
1092158881 12:6304187-6304209 GGAGGGGGAAGATCAGGAAGAGG + Intergenic
1092257714 12:6936442-6936464 GAAGGGGGAGGCAGAGGAAGAGG - Exonic
1095684983 12:45023386-45023408 GAAGAGAGATGCTAAGGATGTGG - Intronic
1095773759 12:45990612-45990634 GGAGGGAGACGCGCAGGGAGGGG - Intronic
1096441535 12:51647769-51647791 GAAGGGAGGAGCCCAGGGAGTGG + Intronic
1097626129 12:62002712-62002734 GAAGAGAGAAATTCAGGAAGGGG - Intronic
1099857250 12:88182959-88182981 GAAGGGAGACCCTGTTGAAGGGG + Intronic
1100786777 12:98087186-98087208 GAATGGAGACGTTCAGTAAAAGG + Intergenic
1102148106 12:110669745-110669767 ACAGGGAGAGGCTCAAGAAGTGG + Intronic
1102176584 12:110880128-110880150 GAAGCTAGATGCTCAGCAAGGGG - Intronic
1103420185 12:120774477-120774499 GAAGGGATAGGCTGAGGAATAGG - Intronic
1104635885 12:130437633-130437655 GAAGAGAGGGGCTCAGGCAGAGG + Intronic
1104876938 12:132041472-132041494 GAAGGCAGACCCGAAGGAAGAGG - Intronic
1105251042 13:18698455-18698477 GATGGGGGAAGCTCAGGCAGGGG - Intergenic
1105456383 13:20544867-20544889 GCAGGGAGAAGCTGAGGGAGGGG + Intergenic
1105917199 13:24927489-24927511 GAAGGGAGCCCCTGTGGAAGGGG - Intergenic
1106602500 13:31200024-31200046 GAAGGGAGACGCGCGGGGAGCGG - Exonic
1106823067 13:33488099-33488121 TAAGGGAGAGGCAGAGGAAGAGG - Intergenic
1113158302 13:107350679-107350701 GTAAGGAAACGCTCAGGAAAAGG - Intronic
1114317685 14:21523356-21523378 GCAGGGAGAGGCTCAGAGAGTGG - Exonic
1114657084 14:24322746-24322768 GCAGGGAGAAGGCCAGGAAGGGG - Intronic
1115788014 14:36847946-36847968 GAAGGGGGGCCCTAAGGAAGAGG + Intronic
1119173039 14:72549177-72549199 CAAGGGAAACCGTCAGGAAGTGG + Intronic
1120526450 14:85582334-85582356 GAATGGAGACCCTAAGGAAGAGG + Intronic
1121109204 14:91300938-91300960 GGTGTGAGACACTCAGGAAGGGG - Intronic
1121242876 14:92442639-92442661 AAAGGGGGACACTGAGGAAGGGG + Intronic
1121856688 14:97276719-97276741 GAAGGAAGAAACTCAGGCAGGGG + Intergenic
1122649799 14:103220279-103220301 GAAGGGAGCCGCGTGGGAAGCGG + Intergenic
1123067688 14:105626740-105626762 GAGGGGAGAGGCTGAGGAGGAGG - Intergenic
1123071707 14:105645465-105645487 GAGGGGAGAGGCTGAGGAGGAGG - Intergenic
1123091371 14:105743741-105743763 GAGGGGAGAGGCTGAGGAGGAGG - Intergenic
1123097142 14:105772082-105772104 GAGGGGAGAGGCTGAGGAGGAGG - Intergenic
1124887777 15:33702780-33702802 TAAGGGAGTCGCTGAGGAAAAGG + Intronic
1125174506 15:36805300-36805322 GCTGGGAGACCCTCAGGAATGGG - Intronic
1126031316 15:44501402-44501424 GAAGAGAAACGCTCATGAAAGGG - Intronic
1129310255 15:74702661-74702683 TAAGGGATACGCACAGGACGAGG + Intergenic
1130513525 15:84608168-84608190 GAAGGGAGAGGGAAAGGAAGAGG - Intronic
1130624886 15:85503978-85504000 GAAGGGACATGCTCAGGCATAGG + Intronic
1131292475 15:91118624-91118646 GTAGGGAGCCTCTCAGAAAGGGG - Intronic
1132634037 16:934135-934157 GATGGCAGAGGCTAAGGAAGGGG + Intronic
1133739286 16:8639617-8639639 GAAAGGAGACTGTCAGGAGGAGG - Intronic
1133876548 16:9740307-9740329 GAAGGAAGAGCCTCAGGAAGTGG + Intergenic
1134461715 16:14435215-14435237 GAAGGGAGAGGAGCAGGAAGGGG + Intergenic
1136599080 16:31272059-31272081 GAAGGGAGCCGTTCAGACAGGGG + Intronic
1137088556 16:36159309-36159331 TAAGAGATACGGTCAGGAAGAGG + Intergenic
1137093066 16:36218532-36218554 TAAGAGATACGGTCAGGAAGAGG + Intergenic
1138065747 16:53939553-53939575 GAAGGAAGATGCTCTGGAATTGG - Intronic
1140222754 16:73056061-73056083 GAAGGGAGACACACAGACAGAGG + Intronic
1141771999 16:86095052-86095074 GAAAGTAGAGGCTCAGAAAGGGG + Intergenic
1142296285 16:89224673-89224695 GATGGAAGAGGCTCAGGCAGGGG - Intronic
1142362578 16:89634512-89634534 GAAGGGGAACGCAGAGGAAGGGG - Intronic
1143386757 17:6535494-6535516 GAATGCAGATGCTCTGGAAGAGG + Intronic
1143391409 17:6561213-6561235 GAAGGGAGAGGAGGAGGAAGAGG - Intergenic
1143732154 17:8887306-8887328 GCAGGGAGAAGCTCAGCATGGGG - Intronic
1144570713 17:16396716-16396738 GCAGGGAGAAGCTGAAGAAGTGG + Intergenic
1144580480 17:16456246-16456268 GAAGGAAGAGGATCAGGAAGAGG + Intronic
1145362851 17:22226490-22226512 GCAGGGAGAAGCTGAAGAAGTGG + Intergenic
1146185224 17:30720179-30720201 GAAGGGAGAAGACCATGAAGGGG + Intergenic
1146264001 17:31439064-31439086 GAAGGGTGAGGTTCAGGCAGTGG - Intronic
1146313300 17:31787779-31787801 GAAGGCAGAGGCTGGGGAAGAGG + Intergenic
1147036301 17:37684010-37684032 GAAGAGTGAGGGTCAGGAAGAGG - Intergenic
1147647342 17:42041627-42041649 GGAGGGAGACCCCCAGGAATAGG - Intronic
1148856354 17:50581115-50581137 GAAGAGAGACGCGCAGGCAGGGG + Intronic
1150277802 17:63910947-63910969 GAAGGGAGCCGCAGAGCAAGAGG + Intronic
1150633700 17:66898184-66898206 GAGGTGAGAGGCCCAGGAAGGGG + Intergenic
1150664977 17:67125848-67125870 TAAGGGAGACGCAGCGGAAGAGG + Intronic
1151128020 17:71866130-71866152 GAAGGCAGGGGCTCAGGGAGAGG - Intergenic
1151443403 17:74148179-74148201 GCAGGGAGAGGCTCAGGATGGGG - Intergenic
1151919256 17:77141210-77141232 GGAGGGACAGGCTCAGCAAGCGG - Intronic
1154411408 18:14144058-14144080 GGACGCAGAGGCTCAGGAAGGGG + Intergenic
1154437807 18:14360459-14360481 GATGGGGGAAGCTCAGGCAGGGG + Intergenic
1156501851 18:37565213-37565235 GGAGGGAGGCGCTCGGGCAGCGG - Intronic
1160135055 18:76264661-76264683 GAACGGAGAGCCTTAGGAAGAGG - Intergenic
1160779969 19:873209-873231 GAAGAGACAGACTCAGGAAGTGG + Intronic
1161106922 19:2448306-2448328 GACGGGACACCCTCAGGATGGGG + Intronic
1161673859 19:5631235-5631257 GAGGGGAGACGCACTGGGAGGGG - Intronic
1162395503 19:10416400-10416422 GATGGGGGACGCACAGGCAGAGG - Intronic
1162511333 19:11120566-11120588 GCAGAGAGAGGCTCAGGAGGGGG - Intronic
1162909124 19:13840040-13840062 GTGGGGGGAGGCTCAGGAAGGGG + Intergenic
1163511721 19:17739487-17739509 GAGGGGAGACGCAGGGGAAGCGG + Intergenic
1163688509 19:18725666-18725688 GAGGTGGGAGGCTCAGGAAGAGG - Intronic
1163807560 19:19408867-19408889 GAAGGGGGACCCTCTTGAAGGGG + Intronic
1164754241 19:30678246-30678268 GCTGGGAGATGCTCAGGATGCGG + Intronic
1165894965 19:39136099-39136121 GAAGGGGGATGATGAGGAAGGGG - Intronic
1165945528 19:39439625-39439647 GAAGAGAGAGGTACAGGAAGGGG - Intronic
1166929700 19:46294892-46294914 CAAGGGAGAAACTGAGGAAGGGG - Intergenic
1166982490 19:46639419-46639441 GAAGGGAGACGGGCGGGGAGGGG + Intergenic
1167098076 19:47386056-47386078 GAGGGGAGACGCTCAGGAGGTGG + Intergenic
1167098861 19:47391721-47391743 GAGGGGAGAAGCTCAGGAGATGG - Intergenic
1167394313 19:49217810-49217832 GAGGGAAGACGCACAGGTAGAGG - Intergenic
1167611868 19:50511635-50511657 GAAGGGAGACCCTGGGGAAGTGG + Exonic
1167831674 19:52028135-52028157 GAACGCAGTCGCTGAGGAAGCGG - Intronic
1168101717 19:54144916-54144938 GGTGGGAGAGGGTCAGGAAGTGG + Intronic
1168139436 19:54375361-54375383 GAATGCAGAGGCTCAGGATGCGG + Intergenic
1168651624 19:58095923-58095945 GAAGGGAGATGAACAGGGAGAGG - Intronic
1202682081 1_KI270712v1_random:15395-15417 TAAGAGATATGCTCAGGAAGAGG + Intergenic
925577212 2:5372721-5372743 GAAGGGAGAGTGTCAGGGAGAGG + Intergenic
925601083 2:5609349-5609371 AAAGGGAGGGGCTCAGGCAGTGG - Intergenic
926157190 2:10462839-10462861 GAAGGGATCCGCCCAGGGAGGGG + Intergenic
926716557 2:15928759-15928781 GAAGGGAGACGCTGACCAACAGG + Intergenic
926829207 2:16941973-16941995 AAAGTGAGATGCTAAGGAAGTGG - Intergenic
926907237 2:17816910-17816932 AGAGGGAGAAGCTCAGGATGAGG + Exonic
927489359 2:23510544-23510566 GTGGGCAGACCCTCAGGAAGGGG - Intronic
929947300 2:46380954-46380976 GAAGGGAGACACTGAGGTACAGG - Intronic
930510416 2:52337266-52337288 GTGGGTAGAGGCTCAGGAAGTGG - Intergenic
932229726 2:70072961-70072983 GAAGGGAGAAGCTGAGGGGGAGG + Intergenic
936083640 2:109452271-109452293 GAGGGGTGGGGCTCAGGAAGCGG - Intronic
936694963 2:114935225-114935247 GAAGGGAAACGATGACGAAGGGG - Intronic
938034903 2:128027716-128027738 GAAGGGAGAGGCACCGGGAGGGG - Intronic
938636580 2:133234156-133234178 GAAGGGAGACTCTTATGAAGGGG + Intronic
939045990 2:137250818-137250840 GAAGGGAGACATTCAGGCAGAGG - Intronic
939258996 2:139782602-139782624 GAGGGGAGAGGCTCAAGCAGGGG - Intergenic
941640181 2:167978767-167978789 GAAGGCAGCGGATCAGGAAGAGG - Intronic
943604351 2:189959021-189959043 AAAGAAAGAAGCTCAGGAAGGGG + Intronic
947752141 2:232538738-232538760 GGAGGGGGAAGCTCAGGAAGGGG + Intergenic
947752167 2:232538834-232538856 GGAGGGAGAAGCTCAGGGAGGGG + Intergenic
1169331145 20:4717402-4717424 GAAAGGAGAGGCCCAGGAAAGGG - Intergenic
1170917757 20:20644676-20644698 GAAGGGAGAAGTTGGGGAAGGGG - Intronic
1172277735 20:33689257-33689279 GAAGGAAGAGGCTCAGAGAGGGG + Intergenic
1172599418 20:36173609-36173631 GAAGGGAGAGACAGAGGAAGTGG - Intronic
1173216866 20:41093465-41093487 GAAGGGGGACTGTCAGGAAAGGG - Intronic
1175120259 20:56711111-56711133 GAAGGGAGAGGAGGAGGAAGGGG - Intergenic
1175248628 20:57596086-57596108 GAAGGGGGTGGCTCAGGATGGGG + Intergenic
1176861646 21:14014359-14014381 GGACGCAGAGGCTCAGGAAGGGG - Intergenic
1177823857 21:26061033-26061055 GAAGTGAGAAGACCAGGAAGGGG + Intronic
1178225852 21:30717555-30717577 GAAGGGAGAAGAGGAGGAAGAGG + Intergenic
1179570045 21:42273299-42273321 GCAGGGAGACGGGCATGAAGGGG + Exonic
1180004282 21:45012895-45012917 GAAGGGAGCAGCTGGGGAAGAGG + Intergenic
1181057934 22:20268574-20268596 GAAGGGAGTGGGTCAGGCAGAGG - Intronic
1181527443 22:23498201-23498223 GAAGGTAGACACTAAGGAAGGGG - Intergenic
1182667571 22:31970787-31970809 GAAGGGAGGGGCTGGGGAAGTGG - Intergenic
1183024726 22:35056296-35056318 GAGGGCAGACACTCAAGAAGCGG + Intergenic
1184334603 22:43845684-43845706 GAACCGAGACGCACAGGAGGAGG + Intronic
950007918 3:9703575-9703597 TAAGGGAGTGGCTCAGTAAGAGG + Intergenic
951054261 3:18129088-18129110 AAAGCGAGAGGCTGAGGAAGAGG - Intronic
952968920 3:38638366-38638388 TAAAGAAGAGGCTCAGGAAGAGG + Intronic
953211286 3:40877499-40877521 AAAGGGAGACACTTTGGAAGTGG + Intergenic
953774541 3:45804044-45804066 GCAGGGAGAATCTCAGGTAGAGG - Intergenic
954373208 3:50180572-50180594 GAATGGAGAGGCCCAAGAAGAGG + Intronic
955203707 3:56876197-56876219 GAAGGGAGTGGTTCAGGAGGTGG + Intronic
955329628 3:58036385-58036407 GCAGGTAGGGGCTCAGGAAGTGG + Intronic
959905708 3:111708979-111709001 TGAGGGACACGCTCAGGAAGAGG + Intronic
959984848 3:112561483-112561505 GAAGGGAAAGGCACTGGAAGTGG - Exonic
960084959 3:113580796-113580818 GAAGGGAGATACACAGTAAGAGG - Intronic
961740078 3:129027541-129027563 GCAGTGAGAGGCTCAGCAAGGGG + Intronic
962772886 3:138629714-138629736 GAAGGTAGACGAACAGGAAAGGG + Intronic
963264585 3:143228200-143228222 GAAGGGAGAAGCTGAGGCCGGGG - Intergenic
963264647 3:143228424-143228446 GAAGGGAGAAGCTGAGGCCGGGG + Intergenic
966582574 3:181584764-181584786 GAAGGGATAGTCTCAGGAGGTGG + Intergenic
966874825 3:184315732-184315754 AAAGAGTGGCGCTCAGGAAGAGG - Exonic
967023498 3:185543801-185543823 AAAGGGAGAAGCTTAGGAAAAGG - Intronic
967449162 3:189603295-189603317 GAAGAGAGAGGCCCAGAAAGTGG - Intergenic
967515384 3:190362443-190362465 GCAGGTAGGGGCTCAGGAAGTGG - Intronic
967752051 3:193126331-193126353 GAAGGGGGAAGCTCTGGAAGGGG - Intergenic
968713691 4:2139029-2139051 GAAAGGAGATGCTCATGCAGTGG + Intronic
968742726 4:2339662-2339684 GAGGGGACACACTCAGGGAGGGG + Intronic
968928600 4:3563315-3563337 GCAGGTAGGGGCTCAGGAAGTGG - Intergenic
969595733 4:8148397-8148419 TGAGGGAGCCGCTCAGGACGCGG + Intronic
970925801 4:21450575-21450597 GAAGGGAGAGGAGGAGGAAGAGG + Intronic
971177089 4:24292506-24292528 GTAGGGAGGAGCACAGGAAGGGG - Intergenic
971177141 4:24292649-24292671 GTAGGGAGGAGCACAGGAAGGGG - Intergenic
971177407 4:24293386-24293408 GTAGGGAGAAGCACAGGAAGGGG - Intergenic
972210383 4:36829686-36829708 GAAGGGGGAAGCTGTGGAAGGGG + Intergenic
973100263 4:46258970-46258992 GAGGGGAGAAGCTGAGGATGTGG + Intronic
975834296 4:78405748-78405770 GGAGGGAGAGGGTGAGGAAGAGG - Intronic
976493356 4:85697809-85697831 GAAGGGAGACAGGCAGGAAAGGG + Intronic
977821887 4:101481386-101481408 GAAGGGAGAGTCTATGGAAGTGG - Intronic
978945082 4:114485706-114485728 GGAGGTTGATGCTCAGGAAGAGG + Intergenic
981843831 4:149144048-149144070 GAAGGGAGAAGGGAAGGAAGAGG - Intergenic
983937372 4:173511314-173511336 GAGTGAAGACGTTCAGGAAGTGG + Intergenic
984943856 4:184956073-184956095 GAAGGGTGAATCTCAGAAAGAGG - Intergenic
988832371 5:35000248-35000270 GACAGGAGAGGTTCAGGAAGTGG - Intronic
991476663 5:67028552-67028574 GAAGGGAGACGCTCAGGAAGTGG + Intronic
992025751 5:72667221-72667243 GAAGGAGGACACTCAGGAACGGG - Intergenic
993272866 5:85817466-85817488 GCAGGTAGGGGCTCAGGAAGTGG - Intergenic
996998347 5:129726528-129726550 GAAGGGAGAAGGGAAGGAAGGGG + Intronic
997391897 5:133524069-133524091 GAGGGGAGCCGCTCAGGGAGAGG + Intronic
997583738 5:135033047-135033069 GGAGGGAGACGCGCAGGAGCCGG + Intronic
1001101640 5:168819176-168819198 GAAGTGAGACAGGCAGGAAGGGG + Intronic
1001287668 5:170435594-170435616 GAAGGCACAGGCTCTGGAAGAGG + Intronic
1004072098 6:12309158-12309180 GAAGGCAGACCCTCATGAATGGG + Intergenic
1005617848 6:27592557-27592579 GAAGGGAAAGACTGAGGAAGAGG - Intergenic
1005680530 6:28203192-28203214 GAAGGGTGATGCTCCTGAAGAGG - Intergenic
1005972773 6:30774573-30774595 GAAAGGAGGCGCTAAGGAACTGG + Intergenic
1007358986 6:41342010-41342032 GAAGGCAGAGGGACAGGAAGGGG - Intronic
1010232212 6:73545082-73545104 GAAGGGAGAAGAAGAGGAAGAGG - Intergenic
1011484772 6:87830062-87830084 GAAGGGAGAGGAGGAGGAAGAGG - Intergenic
1011693204 6:89888168-89888190 GAAGGGAGAAGAGGAGGAAGAGG + Intergenic
1014804831 6:125817968-125817990 GAAGGGAGACGGGGAGGAAGGGG - Intronic
1015704020 6:136067884-136067906 GAAAAGAGAAGGTCAGGAAGAGG + Intronic
1016099314 6:140077977-140077999 GAAGGAAGACGCTCAGTAAAAGG + Intergenic
1016570656 6:145508226-145508248 CAATGGAGAAGCCCAGGAAGTGG - Intronic
1018135600 6:160775629-160775651 GAAGGCAGACTCTGATGAAGGGG + Intergenic
1018341897 6:162859626-162859648 GAAAGGAGAAGGTCAGAAAGTGG - Intronic
1018457617 6:163965901-163965923 GAAGGGGGAGGCTCAGGGAGAGG - Intergenic
1019473761 7:1234208-1234230 GAAGGGAACAGCTGAGGAAGGGG + Intronic
1019520418 7:1458399-1458421 GGGGCCAGACGCTCAGGAAGGGG - Intronic
1021122800 7:16816016-16816038 GAAGGGAGACAGCCAGGCAGAGG + Intronic
1022472905 7:30692657-30692679 GAGGGGAGACAGGCAGGAAGGGG + Intronic
1022546389 7:31193151-31193173 GAAAGGAGAGGCTCAGGGAGAGG + Intergenic
1024602271 7:50994344-50994366 GAAGTGAGGGGCTCAGGCAGAGG - Intergenic
1024770373 7:52714800-52714822 GAAGGTAGGAGCTCAGGAAGTGG + Intergenic
1026671251 7:72392463-72392485 GATGGGAGAGACTGAGGAAGGGG + Intronic
1028154081 7:87409574-87409596 AAAGGTAAACCCTCAGGAAGTGG - Intronic
1028636282 7:92993324-92993346 GAAGGGGTACGCTCTGTAAGGGG - Intergenic
1029885858 7:103870856-103870878 GGAGGGAGCCGCTCAGCAGGAGG - Intronic
1031375133 7:121015218-121015240 GAAAGGACATGGTCAGGAAGGGG - Intronic
1033422900 7:141218677-141218699 AAAGGGAGAGGGTGAGGAAGAGG - Intronic
1034271070 7:149803658-149803680 GGAGGGAGAGGCTGAGGAACCGG - Intergenic
1034948899 7:155283583-155283605 GAAGGGATAGGCTAAGGAACAGG + Intergenic
1035170590 7:157015284-157015306 GCAGGGAGAGGCTGAGGAGGAGG - Intergenic
1035289879 7:157831137-157831159 AAAGGGAGAAGCACAGGAAGAGG + Intronic
1036630505 8:10511048-10511070 GGAGGGAGGGGCACAGGAAGAGG - Intergenic
1036688489 8:10926837-10926859 CAGGGAAGAGGCTCAGGAAGAGG + Intronic
1036740413 8:11356194-11356216 GAGGGGAGATGCCCAGAAAGCGG - Intergenic
1037836200 8:22216131-22216153 GGAGGGAGGCCTTCAGGAAGCGG - Intergenic
1037940728 8:22949031-22949053 GAAGGGAGACACACAGGGATCGG - Intronic
1039381918 8:37093410-37093432 GAAGAGAAACACTCAGGGAGAGG - Intergenic
1042962162 8:74315348-74315370 GAAGGGAGCCCCTCCGGAAGAGG + Exonic
1043831239 8:84991653-84991675 GAAGGGAGACATTCACGGAGGGG + Intergenic
1044994722 8:97828304-97828326 GAAGGGAGACCCTGGGGCAGGGG + Intronic
1048308167 8:133297702-133297724 GAAGGGAGTCGCTCAGGGCGTGG - Intronic
1048976107 8:139673981-139674003 GAAGGGAAGGGCTCAGGCAGAGG - Intronic
1049287886 8:141786482-141786504 CAAGGCAGACCCTCTGGAAGGGG + Intergenic
1049331639 8:142057140-142057162 AGCGGGAGAGGCTCAGGAAGTGG + Intergenic
1051733851 9:20177904-20177926 GAGGGGACACGCTCAGTAAGTGG + Intergenic
1052341641 9:27369757-27369779 AAATGGAGAAGCTGAGGAAGAGG - Intronic
1052681609 9:31700314-31700336 GAGGGGAGGTGCTCAGGAATCGG + Intergenic
1053295625 9:36911087-36911109 GAAGAGAGAGACTCAGGGAGTGG - Intronic
1053455480 9:38230346-38230368 GAGGAGAGATGCTCAGGAGGGGG + Intergenic
1053614085 9:39745317-39745339 TATGGCAGAGGCTCAGGAAGCGG - Intergenic
1054239432 9:62597076-62597098 TATGGCAGAGGCTCAGGAAGCGG + Intergenic
1054461539 9:65467842-65467864 GCAGGTAGGGGCTCAGGAAGTGG + Intergenic
1054553563 9:66631603-66631625 TATGGCAGAGGCTCAGGAAGCGG + Intergenic
1056407554 9:86289800-86289822 GAAGGAAGAAGATCAGGAGGAGG + Intronic
1056657491 9:88521224-88521246 GAATGGGGACGCGCAGAAAGAGG + Intergenic
1057854908 9:98594495-98594517 GAAGGGAGGGGCTCTGGGAGAGG + Intronic
1058756748 9:108089648-108089670 GAAGGGAGACTTTAAAGAAGTGG - Intergenic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1059642494 9:116231336-116231358 GAAGGAAGAAGATAAGGAAGGGG - Intronic
1059757915 9:117311018-117311040 GAAGAGAGACAGGCAGGAAGGGG - Intronic
1060817829 9:126644692-126644714 GCAGGGACACGGCCAGGAAGTGG - Intronic
1061067102 9:128285364-128285386 GTAGGGAGATGCTCAGGCTGTGG + Intronic
1061259250 9:129470629-129470651 GAAGGCAGACACTAAGGATGGGG + Intergenic
1061492639 9:130954536-130954558 GAAGGCAGAGGCTCAAGATGGGG - Intergenic
1061868536 9:133507711-133507733 ACATGGAGACACTCAGGAAGGGG + Intergenic
1061948396 9:133921550-133921572 GCAGGGAGAGGCACAGGGAGAGG - Intronic
1185637530 X:1563969-1563991 AAAGGGAGATGCTGAGGCAGAGG - Intergenic
1186005216 X:5062648-5062670 GAAGGGAGACACTAGGGGAGGGG - Intergenic
1186123833 X:6391671-6391693 GAAGGGAGGTGCTGTGGAAGTGG + Intergenic
1186725086 X:12349030-12349052 GATGGGAAACGCCCAGCAAGTGG + Intronic
1187539745 X:20180699-20180721 GAAGGGTGGAGCTCAAGAAGTGG - Intronic
1187874163 X:23789969-23789991 GAAAGGAGACTCACAGGAAGGGG - Intergenic
1188148572 X:26644822-26644844 GCAGGTAGGGGCTCAGGAAGTGG + Intergenic
1188480379 X:30630877-30630899 GGAGGGAGAGGCTTAGGCAGAGG - Intergenic
1190221188 X:48513376-48513398 GAAGGCAGACACACAGGCAGAGG - Intronic
1192206828 X:69101908-69101930 GAAGGGAGGCGGGCGGGAAGGGG - Intergenic
1196694889 X:118601073-118601095 GAAGGGAGACAGTCAATAAGTGG + Intronic
1198020868 X:132656765-132656787 AAATGGAGTCACTCAGGAAGAGG + Intronic
1198631306 X:138641763-138641785 GAAGGGAGAGACTGGGGAAGAGG + Intronic
1199392008 X:147290987-147291009 GAAGGTACACACTCAGGAAATGG - Intergenic
1200063783 X:153495347-153495369 GAAGGGAGAGGGAGAGGAAGGGG - Intronic