ID: 991478934

View in Genome Browser
Species Human (GRCh38)
Location 5:67055841-67055863
Sequence TCTATGTGCACAGTGTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991478934_991478935 8 Left 991478934 5:67055841-67055863 CCAAAACACACTGTGCACATAGA 0: 1
1: 0
2: 0
3: 15
4: 158
Right 991478935 5:67055872-67055894 GAACACTACTCAGATTTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991478934 Original CRISPR TCTATGTGCACAGTGTGTTT TGG (reversed) Intronic
902295918 1:15466953-15466975 TCTATGTGGGCAGAGTGTGTAGG - Intronic
902298812 1:15486859-15486881 TCTATGTGGGCAGAGTGTGTAGG - Intronic
903843320 1:26260517-26260539 TCCATGTGCACAGCTAGTTTGGG + Intronic
904842882 1:33384950-33384972 GGTATTTGCACAGTGTGTTTCGG - Intronic
905785494 1:40753602-40753624 TCTATGTGCACAGTGGCATTTGG + Intronic
908043083 1:60136412-60136434 TTTATTTGAACAGTGTCTTTTGG + Intergenic
909071172 1:70995232-70995254 TGAATGTGCATAATGTGTTTGGG + Intronic
911539261 1:99138745-99138767 AACATGTGCCCAGTGTGTTTGGG - Intergenic
911784233 1:101924942-101924964 TGGATGTGCACAGAGTGTTGTGG + Intronic
914889137 1:151607353-151607375 TCTGACTGCACAGTATGTTTTGG + Intergenic
916255484 1:162783164-162783186 TTTATGTGCAGATTGTGTTTTGG + Exonic
917227020 1:172795147-172795169 TCTATGTGGTCAGTGTGATATGG + Intergenic
917350966 1:174077273-174077295 ACTAAGTGCACTGTGTGGTTTGG - Intergenic
917949810 1:180019719-180019741 TCTATTTGTACATTATGTTTTGG - Intronic
923202973 1:231730297-231730319 TCCATGTCTACAGTGGGTTTTGG - Intronic
924835289 1:247640849-247640871 GCAGTGTGCACAGAGTGTTTGGG + Intergenic
1063183142 10:3624632-3624654 TCGATGTTCAGAGTGTGCTTTGG - Intergenic
1063548339 10:7003631-7003653 TCTCTGTGTACAGTGGGTCTTGG - Intergenic
1065592010 10:27272341-27272363 TCCATGTGAACTGTTTGTTTTGG + Intergenic
1066721950 10:38348824-38348846 TTTATGTGCAGATTGTGTTTTGG + Intergenic
1067257265 10:44653731-44653753 TCAATGATGACAGTGTGTTTTGG + Intergenic
1068122899 10:52802247-52802269 GATATGTGCAAAGTGTTTTTAGG + Intergenic
1068156985 10:53212633-53212655 TTTTTGTGAACAGTGTATTTGGG + Intergenic
1071159663 10:82730896-82730918 TCTAAATGCAAAGTGTGTTCTGG - Intronic
1071484130 10:86086753-86086775 TGTGTGTGGACAGTGTGTGTTGG + Intronic
1072213752 10:93271021-93271043 TGTCTGTGGACACTGTGTTTAGG - Intergenic
1074076571 10:110131984-110132006 TCTGTCTGCGCAGTATGTTTTGG + Intronic
1075339086 10:121631254-121631276 TCTATATTCCCAGTTTGTTTCGG + Intergenic
1078460499 11:11511573-11511595 TACATGTGCACACTGTGTTATGG + Intronic
1078678922 11:13456678-13456700 TCTTTGTGCATTGTCTGTTTTGG - Intronic
1079562582 11:21840992-21841014 ACTATGTACACACTGAGTTTTGG - Intergenic
1079566258 11:21886962-21886984 TCTATGTGTCCTGTGTTTTTGGG + Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1086241772 11:84702388-84702410 TCCATTTGCACAGTAAGTTTGGG - Intronic
1087169283 11:95034163-95034185 TCTATGAGCACAGCTTATTTTGG - Intergenic
1087236146 11:95720627-95720649 TCTATCTGCACAGTGAGTCTGGG + Intergenic
1088951708 11:114578284-114578306 TCTATGGCCAGAGTGTGATTTGG - Intronic
1089883186 11:121794703-121794725 TCTGTGGGACCAGTGTGTTTAGG - Intergenic
1089921626 11:122214373-122214395 TATATGTGCCCAGGGTGTTGTGG - Intergenic
1090953240 11:131492660-131492682 TCAAAGTGCACAGTGGGTTCAGG + Intronic
1091013330 11:132026075-132026097 TTAATGAGCACAGAGTGTTTGGG + Intronic
1091023172 11:132119305-132119327 TCTTACTGCACAGTGTGCTTTGG - Intronic
1091341048 11:134814204-134814226 TCTATGTGCACAGGGACTTGGGG + Intergenic
1091857602 12:3752221-3752243 TCTGTTTACACAGTGTGCTTAGG - Intronic
1092717802 12:11409274-11409296 TCAAATTACACAGTGTGTTTTGG - Intronic
1093763960 12:22941415-22941437 TCTTTGAGCACAGTCTATTTCGG + Intergenic
1095358176 12:41302638-41302660 TGAATTTGCACAGTGCGTTTTGG + Intronic
1097949066 12:65406130-65406152 CTTATCTGGACAGTGTGTTTTGG - Intronic
1101126499 12:101640652-101640674 TCTTTTTGCCCAGTGGGTTTGGG - Intronic
1101248887 12:102911803-102911825 ACTTAGTGCTCAGTGTGTTTGGG - Intronic
1103686798 12:122738553-122738575 TCTATGTGCCCTGTGGGTTTTGG + Intergenic
1104171751 12:126288518-126288540 CATATGTGCTCAATGTGTTTTGG + Intergenic
1107677156 13:42809266-42809288 TGTATGTGAACATTGAGTTTAGG - Intergenic
1108163957 13:47672488-47672510 TGTATTTGCACTGTGTGATTGGG + Intergenic
1111426230 13:88086973-88086995 CCTATGTGTACAGTATCTTTGGG - Intergenic
1111498359 13:89084192-89084214 TCTATGTGTACAGTTGGGTTTGG - Intergenic
1114412332 14:22512839-22512861 TCTCTGTTCACACTGTGATTGGG - Intergenic
1116659380 14:47689277-47689299 TCTCTGGGGAGAGTGTGTTTGGG + Intergenic
1119706285 14:76784603-76784625 TCTGTGTGCACATTGTCATTTGG - Intergenic
1119890781 14:78180632-78180654 TCTATGTCCTCAGTGTATATGGG - Intergenic
1120603001 14:86536038-86536060 TGTATGTGAAGAGTTTGTTTGGG + Intergenic
1120938164 14:89919035-89919057 TCTATGTGACCAAAGTGTTTGGG - Intronic
1124138563 15:27056910-27056932 TCTGTGTGCAGTGTGTGCTTGGG + Intronic
1124663639 15:31571833-31571855 TTTATGGCCTCAGTGTGTTTGGG - Intronic
1127006865 15:54580645-54580667 TCTATGTGCAAAGTGTTTCATGG - Intronic
1128661431 15:69504015-69504037 TTTATTTGCCAAGTGTGTTTTGG - Intergenic
1131175809 15:90208985-90209007 TCTATGTGTTCAGTGCTTTTGGG + Intronic
1131255079 15:90856715-90856737 TCCATGTGGACAGGATGTTTGGG - Intergenic
1134334588 16:13286238-13286260 TATATGTGCTCAGCGTGGTTGGG - Intergenic
1135406483 16:22201804-22201826 TCCCTGTGCACAGTGGGCTTGGG - Intergenic
1137848644 16:51716026-51716048 ATTATGTGCCCAGTGTGGTTAGG + Intergenic
1138024382 16:53511381-53511403 TCTCTGAGCAAGGTGTGTTTAGG + Intergenic
1144145503 17:12393904-12393926 TCAATGTGGACAGTTTGTTATGG - Intergenic
1144185582 17:12792107-12792129 GATATGAGCTCAGTGTGTTTGGG - Intronic
1147228879 17:39002673-39002695 CCTCTGTGCACATTATGTTTTGG + Intergenic
1149439498 17:56662886-56662908 TCTATGTGATTAGTGTCTTTAGG + Intergenic
1151095082 17:71488060-71488082 TCTGTGTCTACAGTTTGTTTCGG - Intergenic
1156323775 18:36054026-36054048 TTTATGTGCACAATGAGTTTGGG + Intronic
1156884073 18:42113761-42113783 TATATATACACAGTGTGCTTGGG + Intergenic
1158182284 18:54730113-54730135 TCTAATTGTACATTGTGTTTGGG + Intronic
1158809243 18:61012316-61012338 TCTGTATGCAGAATGTGTTTAGG + Intergenic
1164713757 19:30376909-30376931 TCTGTGTGCACAGTGGGTACGGG + Intronic
1165354863 19:35297757-35297779 TGTATGTGTACAGTGTATATAGG - Intronic
1165354954 19:35298799-35298821 TGTATGTGTGCAGTGTGTGTGGG - Intronic
1167815075 19:51873162-51873184 TCTATGGGTGCAGTGTGTGTGGG - Exonic
925753060 2:7107124-7107146 ACTATGTGCAGAGTGTGCTGAGG + Intergenic
926259881 2:11249484-11249506 TCTATGTGGACATACTGTTTTGG + Intronic
927720353 2:25378246-25378268 TGAATGTGCACAGTGAGTTTAGG + Intronic
928021129 2:27706092-27706114 GCTATTTGCACGGTGTGTTCCGG - Exonic
929016998 2:37507683-37507705 TTTAGCTGCCCAGTGTGTTTGGG - Intergenic
929835278 2:45390837-45390859 TTTATGTGTACAGTGAGATTTGG - Intronic
931230937 2:60374257-60374279 TTTATGTGATCAGTGTATTTGGG - Intergenic
932720356 2:74134368-74134390 TCTATCTGCACAGTGGGGTTGGG - Intronic
933667782 2:84978533-84978555 TACATGTGCACAATGTATTTGGG + Intronic
937061522 2:118983513-118983535 TTTTTATGGACAGTGTGTTTGGG + Intronic
939121219 2:138119650-138119672 TGTATGTGGTCAGAGTGTTTTGG + Intergenic
939436092 2:142180178-142180200 TCCATCTGAACAGTTTGTTTGGG - Intergenic
940059070 2:149545119-149545141 TACATGTGCACAGTGTGTGCAGG + Intergenic
942622853 2:177866382-177866404 TCTTTGGTCACAGTGTGGTTTGG - Intronic
943071368 2:183144279-183144301 TCTATGTCCACAGTTTTTATTGG + Intronic
943944464 2:194042177-194042199 TCATTGTGCAGAGAGTGTTTGGG + Intergenic
946737403 2:222767857-222767879 TCTATGTAAAAAGTGTGTATAGG + Intergenic
947313324 2:228828004-228828026 TTTATGTGCAGAATGTGTTGTGG - Intergenic
947758029 2:232582732-232582754 TGTATGTGTAGAGTGTGCTTAGG + Intronic
1171510246 20:25676562-25676584 CCTATGTGTGCAGTGTGTGTGGG - Exonic
1172127159 20:32631421-32631443 TAGATGTGCATATTGTGTTTAGG - Intergenic
1172142113 20:32730252-32730274 TCCCTGTGAACAGTGTGTATGGG + Intronic
1172834389 20:37863681-37863703 CCTAGGTGCACAGTGAGTTTGGG + Intronic
1173056672 20:39621281-39621303 TCTATATTAACAGTGTTTTTTGG - Intergenic
1173311214 20:41897519-41897541 CCTATGTGAACAGTGTGGATAGG + Intergenic
1174737653 20:52981005-52981027 TCTATGTGCACGGTGCCATTTGG + Intronic
1176366670 21:6037425-6037447 TCTAAGTGCACTGTGACTTTGGG - Intergenic
1177418215 21:20822163-20822185 AATATGTGCACTGTATGTTTGGG - Intergenic
1178331457 21:31697787-31697809 ACTAAGTGTAAAGTGTGTTTTGG + Intronic
1179215405 21:39362956-39362978 TATATGTGTATATTGTGTTTGGG - Intergenic
1179756847 21:43501119-43501141 TCTAAGTGCACTGTGACTTTGGG + Intergenic
1180021558 21:45131628-45131650 GCTCTGTGCACAGTGTGGTGTGG + Intronic
1183014461 22:34974383-34974405 TCTATGTGCACAGTATAAGTAGG + Intergenic
1185194205 22:49458356-49458378 TGTATGTCCACACTGTGTGTGGG + Intronic
1185298252 22:50064774-50064796 TCCATGGGCACAGAGGGTTTTGG - Intronic
949665603 3:6335279-6335301 TCTATGTGCCAAGAATGTTTTGG + Intergenic
950002523 3:9668227-9668249 TCTATGTGCTTACTGTGATTTGG - Intronic
953445515 3:42961615-42961637 AATATGTGCCCACTGTGTTTTGG - Intronic
954595748 3:51822779-51822801 TCTGTGTGCACAGCGTGGTGGGG + Intronic
955614529 3:60792686-60792708 TCTATGAGCAAAGTGCTTTTTGG + Intronic
955691490 3:61594823-61594845 GAAATGCGCACAGTGTGTTTGGG + Intronic
962196591 3:133368993-133369015 CCTATGTGCAGAGTGCTTTTAGG - Intronic
967576023 3:191094211-191094233 TCTATGTGCAAAGCATATTTGGG - Intergenic
967875043 3:194262855-194262877 TCATTTTGGACAGTGTGTTTAGG + Intergenic
972727725 4:41760116-41760138 CCTATGTGCACAGAGTGACTGGG + Intergenic
973152431 4:46905378-46905400 TCTAAGAACACAGTGTGCTTTGG - Intronic
976511278 4:85911911-85911933 TCTATGTCTACAGTCAGTTTGGG + Intronic
980140345 4:128908505-128908527 TCTATATGTACAGTTTGTTTTGG + Intronic
982293164 4:153799815-153799837 TCTATGTGGAAAGAGTGATTTGG + Intergenic
983302385 4:165943837-165943859 TACATGTGCACAGTGTATATTGG + Intronic
983980080 4:173984869-173984891 TCTATCTGCTAACTGTGTTTTGG + Intergenic
984293860 4:177829486-177829508 TCTATGTGTACATTGTAATTGGG + Intronic
985038227 4:185862509-185862531 TCTAAGTGGACCTTGTGTTTAGG - Intronic
986941737 5:12959645-12959667 TCTTCATGCACACTGTGTTTGGG - Intergenic
987521933 5:18996987-18997009 TCTTTGTGCACTTTGTGTTTTGG + Intergenic
991449963 5:66741346-66741368 ACTATGTGCCAAGTGTGGTTTGG - Intronic
991478934 5:67055841-67055863 TCTATGTGCACAGTGTGTTTTGG - Intronic
993835867 5:92819333-92819355 TTTCTGTGCAGAGTGTGTCTCGG + Intergenic
994682479 5:102906469-102906491 TACTTGTGCCCAGTGTGTTTGGG - Intronic
1002952244 6:1825526-1825548 TGTAAGTGCACTGTGTGATTTGG - Intronic
1005973375 6:30778787-30778809 GCCATGTGGACAGTGTGTTGGGG + Intergenic
1012697089 6:102399359-102399381 TCTCTGTGCACAGATTTTTTTGG - Intergenic
1014727917 6:124995324-124995346 TCAGAGTGCACAGTGTGTTTTGG - Intronic
1018845794 6:167554471-167554493 GGTATGTGTACAGTGTGTGTTGG + Intergenic
1019841641 7:3452144-3452166 TTTATCTGTTCAGTGTGTTTGGG + Intronic
1020893087 7:13903896-13903918 ATTATCTGCTCAGTGTGTTTAGG - Intronic
1021634525 7:22678642-22678664 TCTAAGAGCTCAGGGTGTTTTGG + Intergenic
1021680753 7:23128865-23128887 TCTTTGAGCACAGTGTTTTTAGG + Intronic
1022221009 7:28313586-28313608 TTTGAGTGCCCAGTGTGTTTCGG + Intronic
1022797376 7:33742814-33742836 TCTATGTGCAGAGTGTCTCCTGG + Intergenic
1028911985 7:96218170-96218192 TAAATGAGCACAGTGTGATTTGG + Intronic
1030130483 7:106195420-106195442 GCTATGTACACACTGAGTTTGGG - Intergenic
1042231794 8:66563581-66563603 TCTAAGTGCAGACTGTTTTTAGG + Exonic
1043198823 8:77336856-77336878 TTTTAGTGCTCAGTGTGTTTTGG + Intergenic
1043830632 8:84984414-84984436 TAAATGTGCACTGTGTGATTGGG + Intergenic
1044952062 8:97444615-97444637 GCAATGTGCTCAGGGTGTTTTGG - Intergenic
1045047330 8:98292052-98292074 AATATTTGCACAGTGTGTGTTGG - Intronic
1050749160 9:8916920-8916942 TTTATGTGCACTGTTTGCTTTGG - Intronic
1051444235 9:17123278-17123300 CCTATGTGCCCATTCTGTTTAGG + Intergenic
1052244844 9:26321971-26321993 TCTCTCTCCACAGTGTATTTTGG - Intergenic
1052743357 9:32415525-32415547 TCTATGTTTCCAGTGTGTTTCGG - Intronic
1056579327 9:87879046-87879068 GGTAAGTGCACAATGTGTTTTGG + Intergenic
1057721195 9:97533462-97533484 TCTATGTGAACAGTGTCTCCTGG - Intronic
1058668177 9:107339141-107339163 TCTAAGGGCACAGTGTGATGTGG - Intergenic
1186609836 X:11128396-11128418 TCTTTGAGCACAATGTTTTTAGG - Intergenic
1193792178 X:85828213-85828235 TCTATGTGTACTCAGTGTTTAGG - Intergenic
1198977318 X:142351347-142351369 TCTATTTTCTCAGTGAGTTTAGG - Intergenic
1199281637 X:146007745-146007767 TCTATGTTCTCAGTGTGCATTGG - Intergenic
1201238969 Y:11939469-11939491 ACTATGTGCCCTGGGTGTTTCGG + Intergenic