ID: 991479278

View in Genome Browser
Species Human (GRCh38)
Location 5:67059695-67059717
Sequence TTTTTAAAAGGGTTTCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 622}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991479278 Original CRISPR TTTTTAAAAGGGTTTCTGTA AGG Intronic
900656178 1:3758896-3758918 TTTTTAAAACTGCTCCTGTAGGG - Intronic
900904901 1:5549331-5549353 TCTTTAAAAATGTTTCTATATGG - Intergenic
901296204 1:8162556-8162578 ATTTTAAAAAGGTCTCTGCATGG - Intergenic
901367978 1:8770320-8770342 TTTTTAAAAGGATGACTGTAAGG + Intronic
902765160 1:18609467-18609489 GTTTTTAAAAGGTTGCTGTAGGG - Intergenic
904808120 1:33145922-33145944 TTTTTACAAGAGATTCTGTTTGG - Exonic
905578248 1:39063187-39063209 TTTTTAAAAAATTTTTTGTAGGG + Intergenic
905780880 1:40708020-40708042 TTTTAAAAATTGTGTCTGTACGG + Intronic
907334023 1:53688724-53688746 TTTTTAAATTGGTTTTTGTGTGG + Intronic
907568736 1:55463190-55463212 TTTATAAAAGGGTGACTATATGG - Intergenic
907585737 1:55616142-55616164 TTTTCCAAAGGATTTCTGGATGG + Intergenic
907956570 1:59233691-59233713 ACATTGAAAGGGTTTCTGTAAGG - Intergenic
908058352 1:60317657-60317679 TTTTTAAAAGGATTGGTGGAAGG - Intergenic
908312154 1:62895241-62895263 TTCTTCACAGGGTTTCTGTCAGG - Intergenic
908592981 1:65652957-65652979 CTTTGAAAGGGGTTTCTGTGTGG - Intergenic
908784936 1:67725641-67725663 TTTTTAAAAGTGTTACTTGAGGG + Intronic
908883268 1:68758229-68758251 TTTTTCAAAGGGTCTGTGAAAGG - Intergenic
910607615 1:89104127-89104149 TTTTTTAAAGGGCTTCACTAAGG - Intergenic
910741293 1:90520813-90520835 TTTCTACAAGGGTTCCTGTGGGG - Intergenic
911143347 1:94529410-94529432 TTTTAAAAAGGTTTTCTATATGG - Exonic
911401038 1:97375478-97375500 TTTTTAACATGGTTTCCTTATGG + Intronic
911590928 1:99746795-99746817 TTCTTAAAAATGTTTCTATATGG - Intronic
911934026 1:103943654-103943676 ATTTATTAAGGGTTTCTGTATGG - Intergenic
912264245 1:108139559-108139581 TTTATGTAAGAGTTTCTGTAAGG - Intronic
913250475 1:116909272-116909294 TTTTTAAATGGGTGTCTTTGTGG + Intergenic
915223139 1:154390909-154390931 TTATTATGAGAGTTTCTGTAAGG - Intergenic
915976380 1:160393143-160393165 TATTTAAAAGGATTTCTTTTAGG + Intergenic
916230873 1:162540160-162540182 ATTTTAAAATGGTTTCTGGGTGG + Intergenic
916909273 1:169327870-169327892 TTTTTTAAAGTATATCTGTATGG - Intronic
917017763 1:170553611-170553633 TTTTTAAATGGGTTTGTTTGAGG + Intergenic
917941333 1:179925028-179925050 TTTTTAAATAGATTTATGTATGG - Intergenic
918493753 1:185110989-185111011 TTTTTAAGAGGGTCTCACTATGG + Intergenic
918629177 1:186695324-186695346 TCTTTAAAAATGTTTCTATATGG - Intergenic
918759878 1:188390525-188390547 TTTTTAAAATGGTTTTTTCAAGG - Intergenic
918924309 1:190761364-190761386 TTTTTAAAAGGTTTTAAGGAAGG + Intergenic
919048688 1:192485508-192485530 TTTTTGAAAGGTTTTTTGAAAGG + Intergenic
919281187 1:195491134-195491156 TTTTTTAAAGAATTTCTTTAGGG - Intergenic
921128815 1:212201503-212201525 TTTTTAAAAGGGTTTGAGTAGGG + Intergenic
921374821 1:214462934-214462956 ATATTAAAAGAGTTCCTGTATGG - Intronic
921732444 1:218593557-218593579 CTTTTAATAGTATTTCTGTAAGG - Intergenic
921857029 1:219998074-219998096 ATGTTAGAAGGGTTTCAGTAGGG - Intronic
921874056 1:220174370-220174392 TTTTTTAAAGGGTGTCTATATGG - Intronic
922142953 1:222908361-222908383 TTTTTAAAAAGGGTTGTGTGAGG + Intronic
922143348 1:222912660-222912682 TTCTTAAAGGGGTTTCTTAAAGG + Intronic
923032509 1:230261322-230261344 TTATTAAAATAATTTCTGTATGG - Intronic
923287360 1:232509184-232509206 TTTGTGAAAGGATTTCTGCAGGG - Intronic
923390330 1:233508417-233508439 TTTTTGAAAGAGTTTGTGTAGGG + Intergenic
923736659 1:236615690-236615712 GTTTTAAAATGATATCTGTAGGG - Intergenic
1063144192 10:3281668-3281690 GTTTTAAAAGAGTTTCTGTTAGG - Intergenic
1063162457 10:3429105-3429127 CTTTAAATAGGATTTCTGTAAGG + Intergenic
1063177923 10:3568938-3568960 TTCTTTAAAGGGACTCTGTATGG - Intergenic
1063219272 10:3951008-3951030 TTTTTTAAAGGGTTGATGTTGGG - Intergenic
1063966083 10:11346996-11347018 TTTTTAAAAAATTTTCAGTAAGG + Intergenic
1064143479 10:12809131-12809153 TTTTAAAAAGTATTTCTGTATGG - Intronic
1064334294 10:14424740-14424762 TTTTTAAAATGTCTTCTCTATGG - Intronic
1065554660 10:26903348-26903370 TTTGGAAAAGTGTTTCTGTTTGG + Intergenic
1065656818 10:27960017-27960039 TTTTTAAAATGGTTTTTATTTGG - Intronic
1066707734 10:38199975-38199997 TTTACAAAAGGAATTCTGTAGGG - Intergenic
1067201083 10:44172662-44172684 TTATTAATAGAATTTCTGTATGG - Intergenic
1067355420 10:45520149-45520171 TACTTCAAAGGGTTGCTGTAAGG + Intronic
1067380293 10:45766919-45766941 TTTTTAAATTGCTTTCAGTAAGG - Intronic
1067934329 10:50595950-50595972 TATTTCAAAGGGTTGCTGTGAGG + Intronic
1068156720 10:53208109-53208131 TTTTTAAAGGTTTTTATGTAAGG + Intergenic
1068484104 10:57634500-57634522 ATTTTAAAAGGCTTTCTATCAGG + Intergenic
1068588458 10:58827732-58827754 TCTTTAAAAATGTTTCTATATGG - Intronic
1069312217 10:67052066-67052088 TTTTTAAATGGGATTTTGTTTGG + Intronic
1069969665 10:72155784-72155806 TTTTTAATTGGGTTTCAGCATGG - Intronic
1070469133 10:76760541-76760563 TTTTTAAAAGGGTACCTATTGGG - Intergenic
1070496694 10:77030854-77030876 TTTTAAAAGGGGCTTCTATAAGG - Intronic
1070560167 10:77560310-77560332 ATATTAAAAGGGTTGCTGCATGG + Intronic
1071038163 10:81273111-81273133 TTTTAAAAATGTTTACTGTATGG + Intergenic
1071319922 10:84444297-84444319 TTTTTAAAAAAATTACTGTAAGG + Intronic
1071555465 10:86598110-86598132 ATTTTAAAAGGCTCTCTGTCTGG - Intergenic
1073366699 10:102948683-102948705 TTTTCAAAAGGTCTTCTGTGTGG + Intronic
1073783656 10:106865407-106865429 TTTTTAATAGGGCTGCTGTGTGG - Intronic
1074993682 10:118736206-118736228 TGTTTAAAAAAATTTCTGTATGG - Intronic
1075279266 10:121125744-121125766 TTTTTAAACGGATTTATGAAAGG - Intergenic
1075305142 10:121361218-121361240 TTTTTAAAAGGGTATCAGGCCGG + Intergenic
1076087881 10:127651251-127651273 TTTTTTAAAGGCATTCAGTAAGG - Intergenic
1076219435 10:128721359-128721381 TTTTTTAATGGGTTTGTATACGG + Intergenic
1077779648 11:5312519-5312541 TGTTTAAAAGGGTTTGTGTTTGG - Intronic
1078583497 11:12558753-12558775 TTTTAAAAAGGGTGTGTGTGTGG - Intergenic
1078620186 11:12900042-12900064 TGTTTAAAAATGTTTCTTTATGG + Intronic
1078940311 11:15996314-15996336 TTTTTAAATTGGTTTTTCTAAGG - Intronic
1079306284 11:19326335-19326357 TTTTGAAAATGCTTTCTGGAAGG + Intergenic
1079413390 11:20210298-20210320 ATTTTAAAAAGGAATCTGTAAGG - Intergenic
1079498535 11:21074732-21074754 TTTTAAAAAAAGTTGCTGTATGG - Intronic
1079764159 11:24369752-24369774 TGTTGAAAAGGGTTTATTTAGGG + Intergenic
1079883273 11:25953137-25953159 TCTGTAAAAGTGTTTCTGAAAGG - Intergenic
1080010191 11:27451038-27451060 TTTTAAGAAGTGTTTTTGTAAGG - Intronic
1081154824 11:39677201-39677223 TTTTTAAACAGGTTGCTGGAAGG + Intergenic
1081949659 11:47033249-47033271 TCTTTAAAAATGTTTCTATATGG + Intronic
1082056522 11:47822237-47822259 TTTTTTTAAAGGTTTCTGAATGG - Intronic
1083051720 11:59783134-59783156 TTTGTAAAAAGCTTTCTATAGGG + Intronic
1084901542 11:72313681-72313703 TTTTTAAATGGGTATTTGTGGGG + Intronic
1084926723 11:72519553-72519575 TTTTTAAAAGCATTTGTGAAAGG + Intergenic
1085609591 11:77934440-77934462 TTTCTAAAAGGGTGACTGCAGGG + Intronic
1085667620 11:78429273-78429295 TTTTGAAAAGGTTTTCCTTAGGG + Intergenic
1085669853 11:78452833-78452855 TTTTTAAAAGTCCTTCTGAATGG + Intronic
1086340891 11:85847028-85847050 TTTTTAAAATGGTTTCAGGCTGG - Intergenic
1086367500 11:86122431-86122453 TTTTTCCAGGTGTTTCTGTAAGG + Intergenic
1087321726 11:96669316-96669338 ATTTTGAAAGGACTTCTGTAAGG + Intergenic
1087368054 11:97247368-97247390 TTTTTAAAACTGCTTTTGTAGGG + Intergenic
1087663963 11:101020703-101020725 TTTTTAAATATTTTTCTGTATGG - Intergenic
1087851103 11:103030345-103030367 TATTTGATAGGGTTACTGTAAGG + Intergenic
1087986907 11:104693946-104693968 TTTTTAAAAAGTTTCCTGTAAGG - Intergenic
1088136528 11:106562295-106562317 GTTTTACAAGGGCTTCTGTTAGG - Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1090165453 11:124542284-124542306 CTTTTAAAAGGATATCTGCAAGG + Intergenic
1090697304 11:129260675-129260697 TTTTTAAAACGGATGCTTTAAGG - Intronic
1090979010 11:131700610-131700632 TTCCTGAAAGGGTTGCTGTAAGG - Intronic
1091188282 11:133666725-133666747 TCTTTAACAGGGTTTTGGTAGGG + Intergenic
1093247540 12:16758573-16758595 TTTTTAAATGGCATTCTGTGTGG + Intergenic
1093344374 12:18023335-18023357 TCTCTAAAAGGGTTTCTATATGG - Intergenic
1094063326 12:26338316-26338338 TATTTAAAACTGTATCTGTAAGG - Exonic
1094158137 12:27359508-27359530 TTTTAAAAAAAATTTCTGTAAGG - Intronic
1095621694 12:44263619-44263641 TTTTTAAAAACAATTCTGTAAGG - Intronic
1096189268 12:49604681-49604703 TATGTCACAGGGTTTCTGTAAGG + Intronic
1096484916 12:51973378-51973400 ACTTTAAAAGGGGTTCTCTATGG - Intronic
1096621848 12:52870193-52870215 TTTTTCATATGGTTTCTGTATGG - Intergenic
1096877082 12:54637920-54637942 TTTTTAAAAAAGGTTCTTTAAGG - Intergenic
1097000232 12:55870203-55870225 TTTTGAAAAGGAATTCAGTATGG - Intergenic
1097335287 12:58376050-58376072 TTTATAAAAAGTCTTCTGTATGG - Intergenic
1097662827 12:62449262-62449284 TTTTTAAAATGGGTTTCGTATGG + Intergenic
1097987803 12:65802840-65802862 TTTTTAAAAGGGATTTTGACTGG + Intergenic
1098102990 12:67038573-67038595 TTTTTAAAAGGGGCTCTGAGAGG - Intergenic
1098345734 12:69501337-69501359 TTTTTAACAGTGATTCTGTGGGG + Intronic
1098523311 12:71458316-71458338 CTTTTAAAAGGGCCTCTGTGAGG + Intronic
1098709914 12:73743631-73743653 TTTTTAAAAATATTTTTGTATGG - Intergenic
1099403613 12:82231331-82231353 TTTTTAAAAGGGAATCATTATGG + Intronic
1099784107 12:87238179-87238201 TTTTTGAAATAGTTTCAGTAAGG - Intergenic
1100608082 12:96168320-96168342 GTTCTAAAATGTTTTCTGTAGGG - Intergenic
1100862441 12:98820691-98820713 TTTTTAAAAGTATTTAAGTATGG + Intronic
1101152775 12:101898514-101898536 TTTTTAAAAGTGTTGATTTATGG + Intronic
1101177272 12:102166961-102166983 TTTTTAAAAAATTTTTTGTAAGG + Intronic
1102052099 12:109870082-109870104 TTCTTCAAAGGGTTGCTGTGAGG + Intronic
1102827238 12:115959277-115959299 TTTTTTAAAGTTTTTTTGTAGGG + Exonic
1102853578 12:116275176-116275198 TATTTAAAATGGTTTTTGTGTGG - Intronic
1102973050 12:117186270-117186292 TTTCCAAAAGGATTTTTGTAAGG + Intronic
1104139174 12:125970775-125970797 TTTTTAAATGAGTTTCTCTAAGG - Intergenic
1104194784 12:126524906-126524928 TTTTGAAAATGGCTTCTGCACGG - Intergenic
1104383734 12:128330386-128330408 TTTTTAAAAGTGTATTTCTAGGG + Intronic
1104539837 12:129653670-129653692 TTTTTAAAAGGAGCTCTGTAGGG - Intronic
1105018294 12:132799469-132799491 TTGTTTAAAAGTTTTCTGTAAGG - Intronic
1105930130 13:25044510-25044532 CTTTTAAAAGAGTTTCTCTTGGG + Intergenic
1105986570 13:25573105-25573127 TTTTTAAAAAAGCTTCTGTACGG - Intronic
1106423388 13:29602612-29602634 TTTTTAAAAGTGTAGCTGTTGGG + Intergenic
1106596503 13:31145109-31145131 TTTTTACATGGTTTTCTGTATGG - Intronic
1106715168 13:32380990-32381012 TTTTTAAATGTGTTTGTGTTTGG + Intronic
1106956722 13:34946825-34946847 TTGTTAAAAGGGTAACTTTAAGG + Intronic
1106960498 13:34991811-34991833 TTTTTAAAAGTGCTTTTATAAGG - Intronic
1106996817 13:35493939-35493961 TTTTTAAAAGATTTATTGTAAGG - Intronic
1107608572 13:42088590-42088612 TTTTTAAAGTGGTTTCTCTAAGG - Intronic
1107753322 13:43592918-43592940 TTTATGAAAGTGTTTTTGTATGG - Intronic
1107794756 13:44038792-44038814 TTTTTAAAGTTGTTTCTGTGTGG - Intergenic
1108002203 13:45914728-45914750 TTTTTAAATTGTTGTCTGTAAGG + Intergenic
1109129249 13:58560509-58560531 TTTTCAAAAGGGTGTTTGGAGGG + Intergenic
1109160080 13:58961159-58961181 TTTTTAAAATTGTTTCAGCAAGG + Intergenic
1109641503 13:65198037-65198059 TTTTTAAGAAGGTTTCAGGAAGG + Intergenic
1110071235 13:71181678-71181700 TTTTAAAAATGATTTCAGTAAGG - Intergenic
1110179068 13:72593662-72593684 TTTTCATAAAGTTTTCTGTAAGG - Intergenic
1111109698 13:83690889-83690911 TTTTTAAAATGGTTTTTAAAAGG + Intergenic
1111593751 13:90384637-90384659 TTTATATAACGTTTTCTGTAAGG + Intergenic
1111822462 13:93229281-93229303 TTTTTAAAAGGTTTATAGTATGG + Intronic
1112466492 13:99649948-99649970 TTTTTAAAAAATTTTTTGTAGGG - Intronic
1112506286 13:99978181-99978203 TTTTTCAACAGGTTTCTGGAAGG - Intergenic
1112561458 13:100518473-100518495 TTATTTGAAGGGCTTCTGTAGGG + Intronic
1112701268 13:102011697-102011719 TTTAGAAGAGGGTTTCTGGAAGG + Intronic
1113165114 13:107431760-107431782 TTCTTAACAGGGGTTCTGTGAGG + Intronic
1113665094 13:112135985-112136007 TTTTTAACATTGTTTCTGTGGGG - Intergenic
1113705509 13:112430000-112430022 TTTTTAAAATGTTTTCTGACAGG + Intronic
1114472282 14:22971853-22971875 TTTTTAAAAAAGTTTTTGAATGG + Exonic
1114684870 14:24519132-24519154 TTTTTATAACCTTTTCTGTATGG + Intergenic
1115081407 14:29455856-29455878 CTTTTAAAAAAGTTTCTATAGGG - Intergenic
1115461692 14:33668274-33668296 TTTTCAAAGGGGCTACTGTATGG - Intronic
1115692694 14:35861247-35861269 TTTTTAAAAGAATTTCTGCTTGG + Intronic
1116102606 14:40460829-40460851 TTTTTAAAAAGTTTTCAGAAAGG - Intergenic
1116790924 14:49339166-49339188 TTTGTTAAAGGTTTTCTGTCAGG + Intergenic
1116916510 14:50531672-50531694 TTTTTAATAGGGCTTATTTATGG - Intronic
1117014541 14:51505327-51505349 TTTCTAAAAGGGTATTTGTTGGG - Intronic
1117026396 14:51624627-51624649 TTTATAAAATGGCCTCTGTAAGG + Intronic
1117254005 14:53960182-53960204 ATTTTATAAGGGTTGTTGTAAGG - Intergenic
1117389816 14:55252042-55252064 TTTTAAAAAAGGTTTCTGGTCGG - Intergenic
1117879234 14:60293548-60293570 TTTTTAAATAGGTTTCTTTCAGG + Intronic
1118123238 14:62869513-62869535 TATTTAAAAGAGCTTCTGCACGG - Intronic
1118595444 14:67431520-67431542 TTTTTAAAATGTTTTGGGTAGGG - Intergenic
1118825389 14:69375608-69375630 TTTTTAAAGTGATTTCTCTAGGG + Intergenic
1119135471 14:72214376-72214398 TTTTTAAAACAGTGTCAGTATGG - Intronic
1119419422 14:74499181-74499203 TTTTAAAAAGGATCTCAGTATGG + Exonic
1120406403 14:84098686-84098708 TTATTAAAACAGTTTCTTTAAGG + Intergenic
1120945357 14:89989954-89989976 TTGTGCAGAGGGTTTCTGTAAGG - Intronic
1121435129 14:93914173-93914195 CTTTTAAAAATGTTTCTGGAGGG - Intergenic
1122368252 14:101211426-101211448 TTTTTAAAAGACTTTGTGAATGG + Intergenic
1123077252 14:105673822-105673844 TTTTTTTAAAGGTTTCTGTCTGG - Intergenic
1124530738 15:30503464-30503486 TTTTTATCAGGGTTTCATTATGG - Intergenic
1124689000 15:31805966-31805988 ATTTTAAGGGGGTTTCTATATGG + Intronic
1124767922 15:32504231-32504253 TTTTTATCAGGGTTTCATTATGG + Intergenic
1125246851 15:37650441-37650463 TCTTTATAAGGGTTTCTGTCAGG - Intergenic
1125848676 15:42883557-42883579 TTTTTAAAGCGGTTGCTATAGGG - Intronic
1125927622 15:43576226-43576248 TATCTCAAAGGGTTGCTGTAAGG + Intronic
1125940765 15:43675791-43675813 TATCTCAAAGGGTTGCTGTAAGG + Intergenic
1126710077 15:51445320-51445342 TTTTTAAAAGTGTTTCCTTTTGG + Intergenic
1126710979 15:51455556-51455578 TTTTTAAAAAAATTTTTGTAGGG + Intronic
1126962145 15:54008930-54008952 TTTTTTAAAGAGTTTCTGGGAGG + Intergenic
1127009758 15:54610519-54610541 TTTGTGCAAGTGTTTCTGTAAGG + Intronic
1127055211 15:55124539-55124561 TTTTTAAAAGAATATCTGCAGGG - Intergenic
1127878482 15:63133452-63133474 TTTTTTAAAGAATTTTTGTAGGG - Intronic
1128426809 15:67550129-67550151 TTTTTTAAAGGGTTTATGGGTGG + Intronic
1131475612 15:92736302-92736324 ATTTTAATTGGGTTTCTTTAAGG - Intronic
1133572445 16:7054554-7054576 ATTTTTTAAGGGTTTCTGAAAGG + Intronic
1134173608 16:11988564-11988586 TTTTTAAAAAACTTTTTGTAGGG + Intronic
1134861814 16:17566892-17566914 TTTTTAAAAATGTTTTTGTAGGG - Intergenic
1135188130 16:20332545-20332567 TTTTTAAAATTTTTTTTGTAGGG + Intergenic
1135514422 16:23118171-23118193 TTTCTAAAAGGATTACTGTAAGG + Intronic
1136619316 16:31417593-31417615 TTTTTAAAAAATTTTTTGTATGG + Intronic
1137392116 16:48090608-48090630 TTTTTAACAAGGTTTCCTTAAGG - Intronic
1137591073 16:49694290-49694312 TTTTTAGAGGGGTCTCTGTATGG - Intronic
1137822292 16:51457689-51457711 TTCTTAAATGTCTTTCTGTAAGG + Intergenic
1137946167 16:52735077-52735099 TTTTTAAATGCTTGTCTGTAGGG + Intergenic
1138087388 16:54145112-54145134 TAATTAAAAGGGTTTGTGTGAGG + Intergenic
1138395148 16:56698353-56698375 TTTTTTGATGGGTTCCTGTAGGG - Intronic
1138504625 16:57471963-57471985 TTTTTAAAAGTGTTTATTTTTGG + Exonic
1138740836 16:59308051-59308073 TATTTAGAAGGGTTTCTGTTTGG + Intergenic
1140189863 16:72806166-72806188 TTTCTAAAACTGCTTCTGTATGG + Intronic
1140504962 16:75465481-75465503 ATTTTAACAGGCTTTCTGAAGGG - Intronic
1141247861 16:82327173-82327195 TTTTTAAAAGGGTTGATATAAGG - Intergenic
1143406541 17:6681467-6681489 TTTTTAAAAAGGTTTCTGGTAGG + Intergenic
1143930057 17:10413195-10413217 TTTTAGAAAGGGATTCTGTAGGG - Intronic
1144486193 17:15666380-15666402 TTTTTAAAAAGCTTTCTCTGAGG - Intronic
1145028145 17:19484793-19484815 CTTTTTATAGGTTTTCTGTATGG + Intergenic
1148804964 17:50259398-50259420 TTTGTGAAAGGGTTGCTGTGTGG - Intergenic
1149187108 17:54011494-54011516 ATTTCCAAAGGGTTTCTGTGTGG + Intergenic
1149970107 17:61209567-61209589 TTTTAAAATGTGTTTCTGTATGG + Intronic
1150365482 17:64579251-64579273 TCTCTAAAAGGGTTTCTTTATGG + Intronic
1150830696 17:68516900-68516922 TTTTGAAATGGGTCACTGTAAGG + Intronic
1151022867 17:70639584-70639606 TTTTGAAAGGGATTTCTGCAGGG - Intergenic
1151849121 17:76679433-76679455 TTTTTAACAGGGTGGATGTATGG + Intronic
1153262556 18:3238526-3238548 TATTTAAAGGGTTTTCTATAAGG + Intergenic
1153412260 18:4807083-4807105 TTTTTAAAAGCTTTGTTGTATGG + Intergenic
1153506600 18:5806048-5806070 TATTAAAAATGGTTCCTGTAGGG + Intergenic
1153559191 18:6353448-6353470 TTTTTAAAATGAATTCTGTCAGG + Intronic
1154259757 18:12820315-12820337 TTTTTAATCTTGTTTCTGTAAGG - Intronic
1154369897 18:13750631-13750653 TTTTTAAAAATTTTTTTGTAGGG - Intronic
1155051241 18:22149629-22149651 TTTTTAAAAAGGATTCTGTAGGG + Intergenic
1155314203 18:24555369-24555391 TTTTTAAAAAGGTTTCTGAGAGG - Intergenic
1155389655 18:25320986-25321008 TTTTAACAAGGTTTTCTGAATGG - Intronic
1155561896 18:27087812-27087834 TTGTGAAAAGGGCATCTGTAAGG + Intronic
1155820895 18:30374471-30374493 TTTTTTAAACCTTTTCTGTAGGG + Intergenic
1156540480 18:37904868-37904890 TTTTAAAAATATTTTCTGTAGGG - Intergenic
1157481366 18:48056188-48056210 TGTTTAAAACAGTCTCTGTATGG - Intronic
1158284052 18:55859183-55859205 TTTTAAAAAGTGTTTCATTAAGG + Intergenic
1159495305 18:69195018-69195040 TTTGAATAAGGATTTCTGTATGG + Intergenic
1159681993 18:71366447-71366469 TTTTTAAAAATGTATCTGTCTGG + Intergenic
1160052467 18:75447776-75447798 CTTTTATAAGGGTACCTGTAAGG - Intergenic
1160131520 18:76229787-76229809 TTTCTAAAATGGTTTCTTTTAGG + Intergenic
1161386292 19:3995337-3995359 TATTAAAAAAGGTTTCTGGAGGG - Intergenic
1161391213 19:4021655-4021677 TTTTTGAAAGAGTTTATGTACGG + Intronic
1162328754 19:10013962-10013984 TTTTTAGAAGGGTTTCACTAGGG + Intronic
1162359764 19:10211861-10211883 GTCTTCAAAGGGTTTCTGGATGG - Intronic
1162539087 19:11282929-11282951 TTTTTAGTAGGGTTTTAGTAGGG + Intergenic
1163926241 19:20346412-20346434 TTTTTAAAAAGCTTTCTGTATGG + Intergenic
1163951692 19:20594020-20594042 TTTTTAAAAGGATTACAGTAGGG + Intronic
1165159545 19:33808005-33808027 TTGTTTAAAGGGTATCTGTTTGG - Intronic
1166061985 19:40331739-40331761 TTTTAAAAAAGGTATCTGTCGGG + Intronic
1166607220 19:44154801-44154823 TTTTTAAAAGTTTTTTTGTAGGG + Intronic
1167833513 19:52047374-52047396 TATTTAAAAGTGTTTATATACGG + Intronic
1168276697 19:55282913-55282935 TTTTTAAAAAAATTTTTGTAGGG + Intronic
925103659 2:1270926-1270948 TCTCTAAAAGGATTTCTGAAAGG + Intronic
925207720 2:2021379-2021401 GCTTTTAAAGGGTTTATGTAGGG + Intronic
925940027 2:8808324-8808346 TTTTTAAAAGGCTTTATGAAGGG - Intronic
926137279 2:10345751-10345773 TTTTTAAAAGTTTTTCTGGATGG - Intronic
926939141 2:18116632-18116654 TTTCTGAAAGGTTTTCTGAAGGG - Intronic
928569749 2:32593648-32593670 TTTTTAAAAGTGTGTCTCTGAGG + Intronic
928899011 2:36297884-36297906 TTTTTAAGAGGCTGTCTGGAAGG - Intergenic
929215758 2:39410653-39410675 TTTTTAAAAAGGTCTTTGCATGG + Intronic
929839214 2:45439496-45439518 TTTTTAAAGTGGTTACTCTAGGG - Intronic
930297040 2:49567875-49567897 TTTTTAAAAGGTCTTTTTTAAGG + Intergenic
930476135 2:51884673-51884695 TTTTAAAAAATATTTCTGTAGGG + Intergenic
930698390 2:54434168-54434190 TTTTTAAACGGGTGTGGGTAGGG + Intergenic
930718253 2:54613569-54613591 TTATTAAAAGGGTTTCCCAAAGG - Intronic
930844911 2:55892875-55892897 TACTTAAAATGGTTACTGTATGG + Intronic
932029279 2:68166634-68166656 TCTCTAAAAATGTTTCTGTAGGG + Intronic
933018293 2:77159807-77159829 TCTCTAAAAATGTTTCTGTATGG + Intronic
935264752 2:101384688-101384710 TTTTTAAAAAACTTTTTGTAGGG - Intronic
935345869 2:102107707-102107729 TTTTGCAAAGGGTTTCCTTAAGG - Intronic
936893407 2:117398613-117398635 TTTTTAATAGGGTTTGTTTTTGG - Intergenic
936893689 2:117402426-117402448 TTTTAAAAAGGGTTTTTCTTGGG - Intergenic
937633526 2:124129872-124129894 ATTCTAAAAGGCTTTCTGTTAGG + Intronic
938328866 2:130434213-130434235 TTTTTAAAACTTTTTTTGTAGGG - Intergenic
938361081 2:130687279-130687301 TTTTTAAAACTTTTTTTGTAGGG + Intergenic
939056144 2:137366886-137366908 TAATTTAAAGGGTTTTTGTAAGG - Intronic
939407642 2:141779337-141779359 TTTTTAAAAGTCTTTCTAGAGGG - Intronic
939487459 2:142832747-142832769 TGTTTAATAGAGTTTCAGTAGGG + Intergenic
939673222 2:145039396-145039418 TTTTTAAAAAGAATGCTGTAAGG + Intergenic
939682614 2:145157332-145157354 TTTATAGAAGGGTTTATTTATGG + Intergenic
939866153 2:147475014-147475036 TTATTGACAGGGTTTCTGCAGGG - Intergenic
940188425 2:151012065-151012087 GTTTCAAAATGGTTTATGTAGGG - Intronic
940251532 2:151682446-151682468 TTGTTAAAAATATTTCTGTAAGG + Intronic
941429121 2:165390287-165390309 TTTGTAAATGGGTTTGTGTTTGG + Exonic
941660989 2:168195228-168195250 TTTTTAAAAAAATTTTTGTAGGG - Intronic
941662237 2:168206787-168206809 TTCTTAAAAGGGTATTTTTACGG + Intronic
941834239 2:169998188-169998210 TTTTTAAAAAGTTTTCTATTTGG - Intronic
942011243 2:171764515-171764537 TTTTTAAAACGGTTTGTTCAGGG - Intergenic
942063363 2:172248080-172248102 GTTATACAAAGGTTTCTGTAAGG - Intergenic
942102468 2:172598740-172598762 TTTATAAAATGTTTTCTGTATGG + Intronic
942254304 2:174079024-174079046 TTTTGAAAAGGGATTCATTATGG - Exonic
942332741 2:174844748-174844770 TATTTAAAAATGTTTCTGTGGGG - Intronic
942471531 2:176265793-176265815 TTTTTAAAAAGGTGTCAGCAAGG - Intergenic
942494490 2:176525522-176525544 TTTTTATAATGGTATCTCTATGG - Intergenic
942566569 2:177270171-177270193 TTCTAAAAATGCTTTCTGTAAGG - Intronic
942578245 2:177389159-177389181 TAAGAAAAAGGGTTTCTGTAAGG - Intronic
942898312 2:181084839-181084861 TTTTTAAAAAAGTTTATCTATGG - Intergenic
943600309 2:189910800-189910822 CTTTTAAAAGGGTGTTTATAAGG + Intronic
943731664 2:191308850-191308872 ATTTTAAAAGGGTTCCAGGAAGG - Intronic
943740428 2:191401155-191401177 TTTTTTAGAGGTTTTCTGGAGGG + Intronic
943972877 2:194433419-194433441 TTTTTAAAATTGCTTCTGTCTGG - Intergenic
944633897 2:201656068-201656090 TTTTAAAAAAGGTATTTGTATGG + Intronic
944651351 2:201833386-201833408 TTTTTAAAAGGGTTTCATATTGG + Intronic
944814864 2:203365098-203365120 TTTTTAAAATGTTTTCAGTATGG - Intronic
944824018 2:203462425-203462447 TTTTTTAAAGGGTTTTTATATGG - Intronic
945558466 2:211308150-211308172 TTTTTAGAAGTGTTTCTCTTTGG + Intergenic
945622315 2:212155999-212156021 TTTTTAAATATGTTTCTGGATGG + Intronic
946296590 2:218788640-218788662 TATTCAAAAGGGTTTCTCCAAGG - Intronic
947078465 2:226369239-226369261 TTTTTAAAAAGTTTTCTTTTTGG - Intergenic
947115492 2:226765786-226765808 TTTTTAAAGTGGCTTCTGTTTGG - Intronic
947386412 2:229595162-229595184 TTACCAAAAGGGTTGCTGTAAGG - Intronic
948639632 2:239367090-239367112 TTTAGAAACGGGTTTCTGTGTGG - Intronic
948775913 2:240288648-240288670 TTTTTAAATGTGTTTTTGTCAGG + Intergenic
1168885734 20:1252915-1252937 ATTTCAGAAGGGTTTCTGAAGGG + Intronic
1169181842 20:3576045-3576067 TTTTCAAATGGGTTTCTATTTGG + Intronic
1169875321 20:10291041-10291063 TTTTTAAAAGGCTATATATATGG - Intronic
1170092013 20:12599676-12599698 TTTTTAAAAGGGCTTCTTTCTGG - Intergenic
1170141237 20:13126871-13126893 TTTAACAAAGGGTTTTTGTATGG - Intronic
1170912690 20:20590324-20590346 TTTTTGAAAGGTTTTGTATAAGG - Intronic
1171072536 20:22088366-22088388 TTTTTAAAATAGTTCCTCTAGGG + Intergenic
1172769084 20:37367814-37367836 TTTTTAAAAAAGTTTTAGTAGGG + Intronic
1172854027 20:37987439-37987461 TTTTAAAAAGTGTTTCTCTTTGG - Intronic
1173746100 20:45438177-45438199 GTTTAAAAAGGCTTTATGTAAGG + Intergenic
1174331882 20:49826588-49826610 TTTTTAAATGAGTGTCTGTCTGG + Intronic
1175181191 20:57148885-57148907 TTTATAAAAAGGTCTCTGGATGG - Intergenic
1175537407 20:59724419-59724441 TTTTTAAAAAGGCATCTGAATGG + Intronic
1175605062 20:60305935-60305957 TCTTCACAAGGGTTTCTGCAAGG + Intergenic
1175735279 20:61381761-61381783 TTTTTAAATAGTTTTCTGAAAGG - Intronic
1175978676 20:62726221-62726243 GTTTTAACTGGGTTTCTGCAAGG - Intronic
1176876222 21:14131568-14131590 TTTTTTAAAGTGCTTCTATAGGG - Intronic
1176926759 21:14759169-14759191 TTTTTAAAAGTGTTTATTTTTGG + Intergenic
1177063624 21:16402190-16402212 TCTCTAAAAATGTTTCTGTATGG + Intergenic
1177300622 21:19240519-19240541 TCTTTATAAAGGTTACTGTAAGG + Intergenic
1178138039 21:29650390-29650412 TTTTTAAAATGCTTCCTATATGG - Intronic
1178454530 21:32736017-32736039 TATTTAACAGTGTTTCTGTTTGG - Intronic
1178562156 21:33648671-33648693 TTTTTAAAAAATTTTTTGTAGGG - Intronic
1178735579 21:35146806-35146828 TTTTGAAAACGGTTTCTTCATGG + Intronic
1180509859 22:16070815-16070837 TTTTTCAGAATGTTTCTGTATGG + Intergenic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1182149517 22:28018330-28018352 TTTTGAAAAGGATCTCTCTAGGG - Intronic
1182190760 22:28458552-28458574 TTTTAAAATTGGTTTCTGAAAGG + Intronic
1183257805 22:36773980-36774002 TTTTTAAATGGGCTTCTCTCTGG - Intronic
1183339042 22:37267997-37268019 TTTTAAAAAACTTTTCTGTAGGG + Intergenic
1183815545 22:40296939-40296961 TTTTTAAAATGATTTCTGAAAGG + Intronic
1183888916 22:40909078-40909100 TATGACAAAGGGTTTCTGTAGGG - Intronic
1183891166 22:40930103-40930125 TTTTTTAAAGGTTTTTTGTGGGG + Exonic
1184064278 22:42107923-42107945 TTTTGAAAAGGGATTCATTATGG - Intergenic
1184427237 22:44418225-44418247 TTTTCAAAAGGGTTTTTCTCAGG + Intergenic
949187736 3:1213829-1213851 TTTTTTAAATGATTTCTCTAAGG + Intronic
950760957 3:15225990-15226012 TTTTTAAAATTGTTTCTATTCGG + Intronic
951001342 3:17563676-17563698 TTTTTAAAAAGGAGTCTGGAAGG + Intronic
951460457 3:22945985-22946007 TTTTAAAAAGGGTTTTCGTCTGG + Intergenic
952329512 3:32351022-32351044 ATTTTAGAAGGGTTTTTGGAGGG + Intronic
952600707 3:35078719-35078741 TCTTTGAAAATGTTTCTGTATGG + Intergenic
953613855 3:44472179-44472201 TTCTTAAAAGTGTTTCTCTCTGG - Intronic
955251441 3:57287037-57287059 TTATTAAAATGGTTTCTCTGAGG + Intronic
955541240 3:59978759-59978781 TTCTCAAATAGGTTTCTGTATGG - Intronic
955683087 3:61522835-61522857 CTTTTAGAAGGCTTTCTCTATGG + Intergenic
955694375 3:61620927-61620949 TTATTAAAAGAGTAACTGTAAGG - Intronic
956073843 3:65484010-65484032 CATTAAAAAGGTTTTCTGTAAGG - Intronic
956259546 3:67323746-67323768 TTTATAAAAGTGATACTGTAAGG + Intergenic
956345781 3:68276783-68276805 TTTTTAAAATAGTTTGTGGAGGG + Intronic
957418592 3:79938276-79938298 ATCTTAAAAGGGTTTCAGTTAGG - Intergenic
958428493 3:94008339-94008361 TTTTTAAAAAAATTTCTGAAGGG - Intronic
958513709 3:95084113-95084135 TTTTTAATAGAGTTAATGTAAGG - Intergenic
958912233 3:100006930-100006952 TTTTAAAAAGTGTTTTTGTTTGG + Intronic
958914409 3:100032672-100032694 TTTTAAAAAATGTTTCTTTATGG - Intronic
959295409 3:104529311-104529333 GCTTTAAAATGGCTTCTGTAGGG + Intergenic
959672374 3:108993697-108993719 TTTTAAAAAGGCATTCTGTTGGG + Intronic
961093756 3:124137638-124137660 TTCTTAAAAGAGTTTCTCCAAGG + Intronic
963226157 3:142863806-142863828 TTTTTAAAAAGCTTTGTGTTTGG - Intronic
963369833 3:144384832-144384854 TGATTAATAGGGTTTTTGTAAGG - Intergenic
963393388 3:144699071-144699093 TTTTTCAAAGTGTTTCTGCTTGG - Intergenic
963482800 3:145897839-145897861 TTTTTAAAATGTTTTCTTTAAGG + Intergenic
963860293 3:150302680-150302702 GTTGTAAAAGAGTTTCTGAAGGG + Intergenic
963916444 3:150862870-150862892 TTTCAAAAATAGTTTCTGTAGGG + Intergenic
965001591 3:162961364-162961386 TTTTTTATTGGGTTTCTGTCAGG - Intergenic
965299551 3:166992707-166992729 TTTTTTCAAGGATTTTTGTATGG - Intergenic
965920045 3:173902400-173902422 TTTTTAAGAGAGTTTATGTAAGG + Intronic
965987768 3:174776905-174776927 TTTTTAAAAGGCTTTCTCTATGG - Intronic
966409438 3:179633235-179633257 TTTTTAAAATTCTTTTTGTAGGG - Intergenic
966490908 3:180527615-180527637 TTTTTAAAACTGTATCTTTAGGG + Intergenic
966552309 3:181218915-181218937 TTTTTAAAATAGTTTCTATTTGG + Intergenic
967523704 3:190467136-190467158 CTTTTAAAAGACTTTCTGAATGG + Intergenic
967582978 3:191181312-191181334 TTTTTACAATGGTTTCTCTCAGG - Intergenic
967667733 3:192193722-192193744 TATTTAAAAGTGTTTCAGTAAGG - Intronic
968142228 3:196267545-196267567 TTTTTAAATTTGTTTTTGTAGGG - Intronic
968249874 3:197199210-197199232 TTTATAAAAGGTTTTCTTAAAGG - Intronic
970625515 4:17874317-17874339 TTTTTAAAGTGCTTTCTGAAGGG + Intronic
970723086 4:19010486-19010508 TTTTCAAAAAGCTTTCTATAGGG + Intergenic
970940025 4:21621025-21621047 TTTTAATAAGAGTTTCTGTACGG - Intronic
971080411 4:23203720-23203742 TTTTTAAGTAGGTTTCTGTTAGG - Intergenic
971147609 4:23995884-23995906 TTGCTAAAAGGGATTCTTTATGG - Intergenic
971203624 4:24538299-24538321 TTTTTAAAGGGGAAACTGTATGG - Intronic
971474659 4:27061234-27061256 TTTTCAAACAGGTTTCTGAATGG + Intergenic
972481587 4:39502172-39502194 TTTTTAAAAGGTTATTTGCAAGG - Intronic
972547075 4:40090188-40090210 TGATTTCAAGGGTTTCTGTATGG - Intronic
973553629 4:52059901-52059923 TTTTTAAATGTATTTTTGTAGGG + Intronic
973838615 4:54837688-54837710 TTATTAAAAGTGTCTTTGTAAGG - Intergenic
974900818 4:67995466-67995488 TCTTTAAAAGGGTCATTGTATGG + Intergenic
975224769 4:71858842-71858864 GTTTGAACAGGGTTTATGTAAGG - Intergenic
976320965 4:83714958-83714980 TTTTTAAAAGGTATTTTGAAAGG + Intergenic
977067260 4:92333710-92333732 TTTTAAAAAGGGTATCTGGTGGG - Intronic
977422803 4:96824664-96824686 TTTTTGAAAAGGTTACTGTCTGG + Intergenic
977436622 4:97004755-97004777 TTTTTAAAAGGTTTTATAAAAGG - Intergenic
977489432 4:97693409-97693431 TTTTTAACTGTGTTTCTTTAAGG - Intronic
978138748 4:105294272-105294294 TTTTTAAAAGTGTTTCCATGGGG - Intergenic
978811400 4:112853562-112853584 TTTTTAAAAGAATTTCTTTAAGG - Intronic
979058334 4:116022239-116022261 TTTTTAAAAATGTCTATGTAAGG - Intergenic
979338857 4:119495979-119496001 TTTTTAAAAGGAGTTATGTTTGG - Exonic
979722630 4:123919790-123919812 TTTTTAACAGGGTTTATGGAAGG + Intergenic
980647413 4:135660347-135660369 TTTTTGAAATAGTTTCTGGAGGG + Intergenic
981019326 4:140008366-140008388 TCTTTAAAAGTGTTTTTGCATGG + Intronic
981173811 4:141656826-141656848 TTTTTGAATGAGTTTATGTAAGG + Intronic
981557751 4:146013781-146013803 TTTTTAAAAACATTTTTGTAGGG + Intergenic
981719621 4:147788144-147788166 TTTTAAAAAGCGTTTCTGAAGGG + Intronic
981872677 4:149505970-149505992 TTTTTACAAGGCTTTCTAAAAGG + Intergenic
983085316 4:163435992-163436014 TAGTTCAAAGGGTTGCTGTAAGG + Intergenic
983775935 4:171607950-171607972 TTTTTAAAATGGTTATTCTAGGG + Intergenic
983917276 4:173306270-173306292 TTTTTAATAGAGTCTCTTTAGGG + Intronic
984731656 4:183074259-183074281 TTTTTTTAAGGGTTTCTTTGGGG - Intergenic
985319509 4:188694113-188694135 TTTTTCAAATGGTTTCGGTGAGG - Intergenic
985803937 5:2025470-2025492 TTTTTTAAAGGCTTGCTGAAGGG + Intergenic
985905613 5:2833619-2833641 ACTTTAAAATGCTTTCTGTAGGG - Intergenic
985981372 5:3468806-3468828 TTTTTGGAAGAGTTTGTGTAGGG - Intergenic
986167059 5:5282807-5282829 TTTTTAAAATGGTTTCTGATAGG - Intronic
986901964 5:12446490-12446512 TTTGTAAAGTGGTTTTTGTAGGG - Intergenic
987236163 5:15943951-15943973 TTTTTAAAAAGTTTTATTTATGG - Intergenic
988075726 5:26351802-26351824 TTTTTAAAAAGTTTTTTTTATGG - Intergenic
988507364 5:31835316-31835338 TTTTCAAAAGTGTTTCTTTTAGG + Intronic
988829791 5:34976411-34976433 TTCTTAAAAGGGAATCTGCAGGG + Intergenic
988889251 5:35597129-35597151 TTTTTAAAATTGTTTCTATTGGG + Intergenic
988963044 5:36388536-36388558 TTTTTAAGAGGCTTTCAATACGG + Intergenic
989210047 5:38849414-38849436 TTTGTAAAAGGGTCTGTGTCAGG + Intronic
989247587 5:39271601-39271623 TTTTGAAAAAGGATTTTGTATGG - Intronic
989303287 5:39920095-39920117 TTTCTGAAAGGATTTCTGGAAGG - Intergenic
989370618 5:40703584-40703606 TTTTTAGAATAGTTCCTGTAGGG - Intergenic
989511150 5:42288923-42288945 TTTTTAAAAATGTCTCTGTCAGG - Intergenic
989829855 5:45902417-45902439 AGTTGAAAAGGGCTTCTGTAAGG - Intergenic
989916427 5:49735344-49735366 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989918150 5:49761411-49761433 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989919200 5:49776920-49776942 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989920409 5:49794638-49794660 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989920873 5:49801291-49801313 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989923842 5:49845407-49845429 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989927601 5:49900598-49900620 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989927878 5:49904855-49904877 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989928792 5:49918140-49918162 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989932482 5:49973323-49973345 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989935172 5:50013193-50013215 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989937143 5:50041990-50042012 TTTTGAAACGTGTTTTTGTAAGG + Intergenic
989938423 5:50110986-50111008 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989938564 5:50113200-50113222 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989938705 5:50115414-50115436 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989938849 5:50117624-50117646 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989938993 5:50119838-50119860 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989939136 5:50122052-50122074 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989939276 5:50124266-50124288 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989939416 5:50126480-50126502 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989939558 5:50128694-50128716 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989939699 5:50130908-50130930 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
989939840 5:50133122-50133144 TTTTGAAACGTGTTTTTGTAAGG - Intergenic
990526401 5:56632122-56632144 CTTTTAAAAGGCTTTCTGCCTGG - Intergenic
990700619 5:58471369-58471391 TTTTGAAATCGGTTTGTGTATGG - Intergenic
991149405 5:63348798-63348820 TTTTTAACTGGGTTGCTTTAAGG + Intergenic
991479278 5:67059695-67059717 TTTTTAAAAGGGTTTCTGTAAGG + Intronic
991650981 5:68853055-68853077 TATTTAAAAATGTTTCTATATGG - Intergenic
992337319 5:75785736-75785758 TTTTTGAAATGGTTTGAGTAGGG - Intergenic
992544792 5:77802501-77802523 TATGTAACAGGGTTTTTGTATGG - Intronic
992611555 5:78512480-78512502 TTCTCAAAAGGCTTTCTGTTTGG - Intronic
993148633 5:84130532-84130554 TTTTAAAAAAGGTGTCTATAAGG - Intronic
993641570 5:90412189-90412211 ATTTTAAAAGGTTTTCAATAGGG + Intergenic
994152901 5:96469743-96469765 TTTTGAAAAGTATCTCTGTAAGG + Intergenic
994407749 5:99366670-99366692 CTTTTAAAGAGGTTTCTGAATGG - Intergenic
994512212 5:100718986-100719008 TTTTTAAAAATGTTTGTGTAGGG + Intergenic
994613033 5:102069799-102069821 TTATTTAAATGATTTCTGTATGG - Intergenic
994735494 5:103548717-103548739 TTTTTAAAAGTGTCTGTGTTTGG - Intergenic
994887620 5:105584899-105584921 ATTTTAAAATAGTTTCAGTAGGG - Intergenic
995455659 5:112349159-112349181 TTTTTAAACTGTTTTCTGTCTGG - Intronic
995540276 5:113179093-113179115 GTTCTTAAAGGGTCTCTGTAAGG - Intronic
996142903 5:119935807-119935829 TTTCTAAAAGTATTTCTGTTAGG + Intergenic
996201756 5:120684534-120684556 TTTTAAAAATAGTTTATGTAAGG - Intronic
996621669 5:125512257-125512279 TTTTAAAAATAGTTTTTGTATGG - Intergenic
996625642 5:125567365-125567387 TTTTTAAAAGGGTATTTTTTTGG - Intergenic
996814565 5:127560507-127560529 TTTTTTAAAGGGTGGCTGTTGGG + Intergenic
997989009 5:138528297-138528319 TTATTTGAAGGGTTGCTGTAAGG - Intronic
1000789944 5:165592902-165592924 TTTTTAAAATGTGTTCTGTTGGG + Intergenic
1000793370 5:165634085-165634107 CTTTTAAAAGGTATTCTTTAAGG - Intergenic
1000970150 5:167705186-167705208 TTGCTAAAAGGGTTACTATAGGG - Intronic
1001287879 5:170436856-170436878 GTTTTAAAAGTGCATCTGTAGGG + Intronic
1001886970 5:175301403-175301425 TTAGTAAAAGAGTTTCTGTGCGG - Intergenic
1002479693 5:179492167-179492189 TTTTTAAAAACATGTCTGTATGG + Intergenic
1002530887 5:179844240-179844262 TTTTTCAAAGGGCATATGTATGG - Intronic
1002693578 5:181069019-181069041 TTTTTAATAGTGTTTTTGTCTGG - Intergenic
1002811616 6:636550-636572 TTTTTAAAGAGTTTTCTGGATGG + Intronic
1003120408 6:3314764-3314786 TTTTTCTAAGGGTTTCTGCACGG + Intronic
1003315143 6:5004721-5004743 TTATTAAAAGCGGTTCTGAAGGG - Intergenic
1003662879 6:8079855-8079877 TTTTTAATAGATCTTCTGTATGG + Exonic
1003744002 6:8979036-8979058 TTTTTAAAATGGTTTGTTTTGGG + Intergenic
1004586578 6:17007745-17007767 ATTTTAAAAGGTTTTCTGTAAGG + Intergenic
1004984779 6:21069050-21069072 ATTCTAATAGTGTTTCTGTAGGG + Intronic
1005131422 6:22512896-22512918 TTTTGAAAGCTGTTTCTGTAGGG - Intergenic
1005635502 6:27749662-27749684 TTTTTAAAATGGAGTCTTTAGGG + Intergenic
1005888816 6:30119551-30119573 TGTTTTAATGGGTTTCTCTAAGG - Intergenic
1006065436 6:31458405-31458427 TTTTTAAAAGGTTTTTTTTCTGG + Intergenic
1006519921 6:34565282-34565304 TTCTTCAAAGGGATACTGTAAGG + Intergenic
1006531783 6:34661698-34661720 ATGATAAAAGGGTTTCTTTAAGG - Intronic
1007535706 6:42586666-42586688 TTTTTAAAATGGTAACTCTAGGG + Intronic
1007740751 6:44008202-44008224 TCTTTAAAAGGCTTCCTGTGGGG + Intergenic
1007855501 6:44851687-44851709 TTTTTAAAAAGGATTCCATATGG + Intronic
1009346683 6:62621288-62621310 TTTTAAACAGGGTTTCAATAGGG + Intergenic
1010535888 6:77029648-77029670 TTTTTAAAAGAGTATTTTTAAGG + Intergenic
1010828619 6:80503415-80503437 TTTCTAAAAATGTTTCTGCATGG - Intergenic
1011667630 6:89650408-89650430 TTTTTAAAAATGTGTCTGGAAGG - Intronic
1011774721 6:90716850-90716872 TTTTTAAAAATGTTTCTGGTTGG + Intergenic
1011961112 6:93091801-93091823 TTTTTAAAAGGGCTTTTATTTGG - Intergenic
1012606551 6:101165230-101165252 TTTTAAAAATGATTTATGTATGG + Intergenic
1012999754 6:106010259-106010281 TTTGAAAAAGGGGTTCTGCAAGG - Intergenic
1013110497 6:107061062-107061084 CTATAAAATGGGTTTCTGTAAGG + Intergenic
1013198365 6:107866142-107866164 TCTTTTCAAGGGTGTCTGTATGG + Intergenic
1013219173 6:108061841-108061863 TTTTTAAAAGGGTTTTTTTTTGG - Intronic
1013467299 6:110429008-110429030 ATTTTTAATGGATTTCTGTAAGG - Intronic
1013787622 6:113799327-113799349 TTTTTAAAAGTGTATATGCATGG - Intergenic
1013921392 6:115408565-115408587 TCTTATGAAGGGTTTCTGTAGGG + Intergenic
1015728772 6:136326649-136326671 TTCTTCAAAGGGTCTCTGTTTGG - Intergenic
1015747203 6:136522862-136522884 TTTTTAAAAAGCTTTTTGTAGGG - Intronic
1016030253 6:139329740-139329762 TTTTTAAAAAGGTCTATGAATGG + Intergenic
1016242051 6:141941890-141941912 TGTCTAGCAGGGTTTCTGTAGGG - Intergenic
1016551647 6:145286918-145286940 TTTTTACATAAGTTTCTGTATGG - Intergenic
1017787162 6:157765947-157765969 TTTTTAAAAGATTTTTTTTAAGG - Intronic
1017814969 6:158010084-158010106 TTTTTAAAAGAATTTTTGTAGGG + Intronic
1017914161 6:158819015-158819037 TTTTTGAAAGAGTTTCTCAAAGG - Intronic
1018192497 6:161322490-161322512 ATTTTAAAAAGGTTTCTAGAGGG + Intergenic
1018236918 6:161735614-161735636 TTTTTAAAAGTGAGACTGTAAGG + Intronic
1019480758 7:1265634-1265656 TTTTTAGGAGGGATTGTGTAGGG + Intergenic
1019525588 7:1479066-1479088 GTTTTGAAAGGGTCTCTGTGAGG - Intronic
1020167929 7:5822919-5822941 TTTGTAAAAGGTTTTTTGTCTGG - Intergenic
1020189836 7:5987023-5987045 TTTTTAAAACGCTTTGTGTTTGG + Exonic
1020950091 7:14664544-14664566 TTTTTTAAAGGGCATGTGTAAGG - Intronic
1021288655 7:18815962-18815984 TTTTTATAAGGTCTTTTGTAAGG + Intronic
1021723620 7:23529555-23529577 TTTTTAAAATCGTTTCTGGCCGG - Intronic
1022258044 7:28678844-28678866 TTATTAAGAGGGTTTCTGCAAGG - Intronic
1022625299 7:32029971-32029993 TTTTTAAAAAGTTTACAGTATGG - Intronic
1025271371 7:57522045-57522067 TTTCTAAAGGGGTTTCAGTTTGG - Intergenic
1026547880 7:71339865-71339887 ATTTTAATAGGGTTTCAGGAAGG - Intronic
1026604375 7:71803366-71803388 CCTTCAAAAGGGTTTCTGTAGGG + Intronic
1027406202 7:77863944-77863966 TTTTAAAAAAATTTTCTGTAGGG + Intronic
1027542996 7:79491919-79491941 TTTCTAAAATTGTTTCTATATGG + Intergenic
1027952127 7:84830115-84830137 TTTTTAAAATAGTTTCTTTCTGG + Intergenic
1028241052 7:88421102-88421124 TTTTTAAACTGTTTTCTGCAGGG - Intergenic
1028489558 7:91395686-91395708 TTTTTTAATGGGCTTTTGTAAGG + Intergenic
1028723164 7:94057438-94057460 TTTTTAAAAGTGTTTTGGGATGG + Intergenic
1030251596 7:107451471-107451493 TCTCTAAAAATGTTTCTGTATGG - Intronic
1030858239 7:114588756-114588778 TATTTTTAAGGGTTTGTGTATGG - Intronic
1031607160 7:123782631-123782653 CTTTCAAAAGTGTTTCAGTATGG + Intergenic
1031892265 7:127308737-127308759 TTCTTAAAAGTGTCTCTGTTTGG - Intergenic
1032455911 7:132073298-132073320 TTTTTAACAGGCTTTCTCTAGGG + Intergenic
1032571426 7:133003860-133003882 TTTTAAAAAGGGTTAATGTTAGG - Intronic
1032877388 7:136052083-136052105 TTTATAAAGGGGTTTTTATAAGG + Intergenic
1032901027 7:136308366-136308388 TGTTTAAAAGAGTTTTTCTATGG + Intergenic
1033237043 7:139646327-139646349 TTTTTAAAAAATTTTTTGTAGGG - Intronic
1033397635 7:140991080-140991102 TTTTTTAAATGGTTTTTTTAAGG - Intergenic
1034625975 7:152493222-152493244 TTTTTAAAAGGATTACTATTTGG - Intergenic
1035055526 7:156032622-156032644 TTTTTAAAATAGTTTGTGCAAGG - Intergenic
1035190214 7:157160813-157160835 TTTTTAAACTGGATTCTGTGAGG + Intronic
1036274003 8:7334521-7334543 TTTTTACATTGGTTTCTGAAGGG + Intergenic
1036347343 8:7975827-7975849 TTTTTACATTGGTTTCTGAAGGG - Intergenic
1036716671 8:11131499-11131521 TTTTAAAAAATATTTCTGTATGG + Intronic
1036842656 8:12136612-12136634 TTTTTACATTGGTTTCTGAATGG - Intergenic
1037289194 8:17333527-17333549 TTTTTAAAAGAGTATCTCTGTGG - Intronic
1037888635 8:22609219-22609241 TTTTTAAAACGTTTTTTGTAAGG + Intronic
1038497910 8:28018395-28018417 TTTTTAAAAAGGTTGCTCCACGG + Intergenic
1038557204 8:28531147-28531169 TTATGAGAAGGGTTTCTCTAGGG - Intronic
1039680000 8:39723362-39723384 TTTATAAATGGTTTTCTCTAAGG + Intronic
1041034191 8:53771279-53771301 TTTTTAAAAGAGTTACTCTCTGG - Intronic
1041038022 8:53815351-53815373 TTATTAAATTGGTTTGTGTATGG - Intronic
1041140702 8:54816288-54816310 TTTCCAAAAAGGTCTCTGTAAGG + Intergenic
1041290041 8:56300181-56300203 TTTTTTTAAGGTTTTCTGAATGG + Intronic
1041884787 8:62795973-62795995 TTTTAAAAAGGGTCTTTGAAAGG - Intronic
1042011294 8:64247960-64247982 TTATTGAAATGGTTTCTCTAAGG + Intergenic
1042112909 8:65400149-65400171 TTTTTAAAAGGGGTTCACTTTGG - Intergenic
1042189144 8:66167914-66167936 TTTTTTAAAAGTTTTTTGTAGGG + Intronic
1042421648 8:68597371-68597393 TTTTTAAAAATGATTTTGTAGGG + Intronic
1042538792 8:69886638-69886660 TTTTTAAAAGGTGTTGTTTAAGG + Intergenic
1042769200 8:72360533-72360555 TTTTTAAAATATTTTTTGTAAGG - Intergenic
1043448491 8:80342395-80342417 TGTTTAAAAGGAGTTCTGAAAGG - Intergenic
1043540008 8:81251030-81251052 TTAATAAAAGTGTTTCTATATGG - Intergenic
1043624632 8:82240928-82240950 TTTTTAAAAGGGTTTCTATAAGG + Intergenic
1043632480 8:82353475-82353497 CTTTTAAAAGGGTTACTGTGAGG - Intergenic
1044305687 8:90638119-90638141 TTTTTAAAAAGATTTCTGCAGGG - Intronic
1045292260 8:100843836-100843858 TTTTTAAAAGAGTTAATTTATGG - Intergenic
1045309736 8:100990667-100990689 TTTTAGACAAGGTTTCTGTAAGG - Intergenic
1045649593 8:104329611-104329633 TTTTTCATCTGGTTTCTGTAGGG - Intergenic
1045757053 8:105556438-105556460 TTTCTAAAAAGGTTGCTGTGAGG - Intronic
1045768924 8:105711057-105711079 TTTTTAAAAGTATTCCTTTAAGG + Intronic
1045906554 8:107353098-107353120 CATTTAAAATGGTTTCTGTGTGG + Intronic
1046424812 8:114032731-114032753 TTTTTAAAAGTAATTCTCTAAGG - Intergenic
1047004825 8:120609581-120609603 TTTTTAAAGGTGGTTCTGCAGGG - Intronic
1047175538 8:122537256-122537278 TTTTTGGGAGAGTTTCTGTAAGG - Intergenic
1047244714 8:123131049-123131071 TTTTTAATAGTGTTTCTCTGGGG - Intronic
1048086981 8:131192781-131192803 TTTTTGAAAGGGATTCCCTACGG + Intergenic
1048237253 8:132703200-132703222 TTTTTAAAAAGTTTCCTTTAAGG + Intronic
1048460048 8:134614073-134614095 TTTTTAAAACAGTTCCTCTAGGG - Intronic
1050257037 9:3805172-3805194 TTTTTTAAATGGTATCTATAGGG - Intergenic
1050622127 9:7465178-7465200 TTTTCATCAGGCTTTCTGTAAGG + Intergenic
1050805707 9:9675201-9675223 TTTTTAAAATGGTTTCTCTAAGG - Intronic
1051316390 9:15837840-15837862 TTTCTAAAAGGCTTTCTAAAAGG - Intronic
1052400803 9:27997910-27997932 CTTTTAAATGGGTTTCAGGAAGG + Intronic
1052511280 9:29424267-29424289 ATTTTAAAATCGTTTCTGCAGGG - Intergenic
1052782063 9:32791521-32791543 TTTTTAAAACATTTTCTGTTTGG - Intergenic
1053210859 9:36226493-36226515 TTTTTAAAAGAGTATTTATAAGG + Intronic
1053240588 9:36491581-36491603 TTATTTAATGGGTTTCTGTCTGG - Intergenic
1054844862 9:69783924-69783946 TTTTTAAAAAAATTTCTGTTTGG + Intergenic
1055123877 9:72696117-72696139 TTTTTAAAAGGATTTTTTTGCGG - Intronic
1055482642 9:76724874-76724896 TGTTTATAAGGATTTCTATACGG + Intronic
1056268191 9:84920668-84920690 TTTTTCAACGGATTTCTGGAAGG - Intronic
1056479281 9:86984597-86984619 TTTTTCAAAGGTTTTCTGGTTGG - Intergenic
1056526227 9:87445533-87445555 GTTATGAAAGGGTTACTGTATGG - Intergenic
1056938958 9:90938727-90938749 TTTCTAAAAGTTTTTCTGCATGG + Intergenic
1057449851 9:95148203-95148225 TTTTAAAAAAGAATTCTGTACGG + Intronic
1057982832 9:99679536-99679558 TTTTGGAAAGGGTCTCTGGAGGG - Intergenic
1058731665 9:107856336-107856358 TTTTAAAAAGGCTTTTTGAAAGG - Intergenic
1059140996 9:111853050-111853072 TTTTTTTAAGAGTTGCTGTACGG + Intergenic
1059147745 9:111916759-111916781 TTTTTAAAATTCTTTCAGTAGGG - Intronic
1059501085 9:114754852-114754874 TGGTTAAAATGGTTCCTGTATGG - Intergenic
1059946430 9:119413045-119413067 TTCTTCATAGGATTTCTGTAAGG + Intergenic
1060050492 9:120375144-120375166 GCTTTAAAAGGGTTTTTGTGGGG - Intergenic
1060207547 9:121691069-121691091 TTTTTAAAAGGATTTCACTTGGG - Intronic
1061472654 9:130839315-130839337 GTTCTAAAAGCGTATCTGTATGG - Intronic
1061636196 9:131910532-131910554 TTTTTTAAAGGGCTACTGAAGGG + Intronic
1186304296 X:8238389-8238411 TTTTTAAATGGGCATCTGGAAGG + Intergenic
1186524155 X:10233016-10233038 ATTTTAAAAGGGTTTATGAAAGG - Intronic
1186601807 X:11046343-11046365 TTTTTGAAATAGTTTGTGTAGGG + Intergenic
1186819336 X:13270912-13270934 TTTTAAGAAGGGTTCCTGTTTGG - Intergenic
1187019041 X:15360635-15360657 TTTTTAAAAAGGTTTCTTGGGGG - Intronic
1187472877 X:19585140-19585162 CTTTTAAAAGTGTTTTTGTGTGG + Intronic
1187643138 X:21316654-21316676 TTTTTAAAAGTGTATTTTTAAGG - Intergenic
1188631330 X:32365258-32365280 TTATGAAACGGCTTTCTGTATGG + Intronic
1188904438 X:35775030-35775052 TTTTAAAAATAGTTACTGTAAGG - Intergenic
1188928016 X:36069234-36069256 TATTTAAAAGGGCTTTTGTGAGG + Intronic
1188993553 X:36853879-36853901 TGTTCAAACTGGTTTCTGTAAGG - Intergenic
1189357311 X:40320277-40320299 CTTTTTAAAGGGTTGCTCTAGGG + Intergenic
1189689546 X:43601632-43601654 TTTTTAAAAGTGTTTATTTTAGG + Intergenic
1191942510 X:66496636-66496658 TTTTGAGAAGTGTTTCTTTATGG - Intergenic
1192304586 X:69945163-69945185 TTATTAAGGTGGTTTCTGTATGG + Intronic
1193143305 X:78052398-78052420 TTTTTAATAGGGTTTTTTTGTGG - Intergenic
1193384081 X:80850411-80850433 GTTTAAACAGGCTTTCTGTAAGG - Intergenic
1193653919 X:84174442-84174464 TTTTTAAAAGAGTCTCAGAATGG + Intronic
1193654006 X:84175713-84175735 TTTTTAAAAATCTTTCTATAAGG + Intronic
1193965771 X:87984204-87984226 TTTTAAATAGGGTTACTTTAAGG + Intergenic
1193997646 X:88385857-88385879 TTTTTAAATTGTTTTCTGAATGG - Intergenic
1194032141 X:88830975-88830997 TGCTTAATAGGGTGTCTGTAGGG + Intergenic
1194619908 X:96158434-96158456 TCTTTAAAAATGTTTCTATATGG - Intergenic
1194694892 X:97034758-97034780 TTTTTAAAAGTGTGTATGTGTGG + Intronic
1195686427 X:107590940-107590962 TTTTTGGAAGGGTTTGTGAAAGG + Intronic
1196047624 X:111272931-111272953 TTTTGAAAAGGGTATCTAAAAGG - Intergenic
1196107831 X:111915329-111915351 TTTTTAAAAGGTTTCCTCTCTGG - Intronic
1196430435 X:115619092-115619114 GTTTTAAAAGTGTTTGTGTGAGG + Intronic
1197329634 X:125137857-125137879 TTTTAAAAAGGAATTTTGTAAGG + Intergenic
1197645031 X:129007999-129008021 TTTATAAAAGAATTTTTGTAAGG - Intergenic
1198206667 X:134472138-134472160 TTTTTACAAAGTTTTTTGTAGGG + Intronic
1198217746 X:134571650-134571672 TTTTTAAAAGGATTTTTTTGGGG - Intronic
1198319742 X:135508461-135508483 TTTTTAAAAAGCTGTCAGTAGGG - Intergenic
1199088026 X:143651615-143651637 TTTTTCATAGGGTTGCTGTGAGG - Intergenic
1199147315 X:144383544-144383566 TTTTTAAAAAGGTTCTTCTAAGG - Intergenic
1199149238 X:144409843-144409865 TCTTAAAAAGGGGTTCTGTTTGG + Intergenic
1199234573 X:145476212-145476234 TTTACAAAAGTGTTTCAGTATGG + Intergenic
1199293038 X:146126373-146126395 TTTTTTAAATGTTTTCTGTAAGG + Intergenic
1199375637 X:147105142-147105164 TTTTTTAAAGGTTTTTTTTAAGG + Intergenic
1199509343 X:148602832-148602854 TTTTTTAAATGGAATCTGTAAGG + Intronic
1199725038 X:150571484-150571506 TTTCTCAAAGGGTTGCTGGAGGG + Intronic
1199767388 X:150951181-150951203 TTTTTAAAAATGTTTTTGTAAGG + Intergenic
1200876157 Y:8156659-8156681 TTGCTAAAAAGATTTCTGTAGGG - Intergenic
1201308178 Y:12569295-12569317 TATGTAAAAGGATTGCTGTATGG + Intergenic