ID: 991481017

View in Genome Browser
Species Human (GRCh38)
Location 5:67079842-67079864
Sequence GAACACAAAGTTCCACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991481013_991481017 0 Left 991481013 5:67079819-67079841 CCTTAATTTATCCTTACCACCAT 0: 1
1: 0
2: 1
3: 9
4: 175
Right 991481017 5:67079842-67079864 GAACACAAAGTTCCACATGCTGG 0: 1
1: 0
2: 1
3: 27
4: 217
991481012_991481017 27 Left 991481012 5:67079792-67079814 CCATTATTTTCTCTGAATTCACA 0: 1
1: 0
2: 6
3: 49
4: 528
Right 991481017 5:67079842-67079864 GAACACAAAGTTCCACATGCTGG 0: 1
1: 0
2: 1
3: 27
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991481017 Original CRISPR GAACACAAAGTTCCACATGC TGG Intronic
904537303 1:31208347-31208369 GAACACAAGTTTCCATAAGCGGG - Intronic
905127055 1:35723055-35723077 GAAAAAAAAGCTCCAAATGCAGG + Intronic
907533267 1:55123540-55123562 GAACACAGATTCCCGCATGCAGG + Exonic
908316237 1:62935466-62935488 GAACACAAAGTGGTACAGGCTGG - Intergenic
911567692 1:99483000-99483022 GAACTCACAGTTCCACGTGTTGG - Intergenic
912207857 1:107527962-107527984 AAACACAAAGCTCAGCATGCTGG + Intergenic
912605229 1:110982815-110982837 GAACTCATAGTTTCACAGGCAGG + Intergenic
915747452 1:158175095-158175117 GAGCACACACTTCCAGATGCTGG + Intergenic
918592018 1:186250650-186250672 GAACTTACAGTTCCACATGGTGG + Intergenic
919895806 1:202009205-202009227 GATCACACAGTTGCAGATGCTGG + Exonic
920440339 1:205976337-205976359 GGACAGAATGTTCCAAATGCAGG - Intergenic
921797546 1:219364384-219364406 GAACGCAAAGGTCAAAATGCAGG - Intergenic
924840424 1:247705114-247705136 GATCACAAAGTTCCACAATCGGG + Intergenic
1064478392 10:15716021-15716043 GAAAAGAAAGTTCCCCATGTCGG - Intronic
1066456570 10:35577395-35577417 CATAACAAATTTCCACATGCTGG - Intergenic
1071756372 10:88545381-88545403 GGACTCACAGTTCCACATGCTGG + Intronic
1072233715 10:93435248-93435270 GAACAAACAGTGCAACATGCTGG + Intronic
1072847535 10:98848781-98848803 GATGAAAAAGTACCACATGCAGG + Intronic
1073797528 10:107004380-107004402 GGACTCACAGTTCCACATGGTGG + Intronic
1075884481 10:125886132-125886154 GAACACCAAGTTCCAGAGGCAGG - Intronic
1076731192 10:132439964-132439986 GAACACACACATCCACATGCAGG - Intergenic
1080787618 11:35490016-35490038 GGACTCACAATTCCACATGCTGG + Intronic
1083087775 11:60168283-60168305 CAACACAAAGTCCCTCATGTGGG + Intergenic
1084320814 11:68372506-68372528 GAGCACCTAGTTCCACTTGCGGG + Intronic
1089167147 11:116486010-116486032 GATGACAAGGTTCCACATGGCGG - Intergenic
1090390783 11:126386010-126386032 GCACAGAAAGTTCCATATGGTGG - Intronic
1092756370 12:11766961-11766983 CAAAACAAAGCACCACATGCAGG - Intronic
1095760804 12:45833578-45833600 TAAAACAAAGTTCAACATTCTGG - Intronic
1095820359 12:46471696-46471718 GAACATAAAGTAAAACATGCAGG + Intergenic
1099132540 12:78853614-78853636 GAATACTAAGATCCACATGAGGG + Intergenic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1101261258 12:103033107-103033129 GAAGTCAAAGTTCCAAGTGCTGG - Intergenic
1103952163 12:124557241-124557263 GTAAACAAAGCTCCACACGCCGG + Intronic
1104862694 12:131932504-131932526 GAACACAGAGTCCCACTGGCAGG - Intronic
1105797736 13:23873094-23873116 GAATACAAAATTCCACCTGGGGG + Intronic
1106933374 13:34691249-34691271 CAAGACAAAGTTGTACATGCTGG + Intergenic
1108637860 13:52353532-52353554 TAACACAAAGTACCACAGACTGG + Intergenic
1108806450 13:54162481-54162503 GAACACAGAGACACACATGCAGG - Intergenic
1109480997 13:62953152-62953174 GAACCCACAATTCCACATTCTGG + Intergenic
1110500699 13:76224398-76224420 TGACTCACAGTTCCACATGCTGG - Intergenic
1110756556 13:79181827-79181849 GAAGGCACTGTTCCACATGCTGG - Intergenic
1111772121 13:92610086-92610108 GAACACAAAGTTCAACTTTAAGG - Intronic
1113878828 13:113611167-113611189 GAGCACAAAGGTGCCCATGCAGG - Intronic
1115418039 14:33159497-33159519 GCACACAAATTTACACATGTGGG - Intronic
1115677558 14:35696195-35696217 GAACATAAAGTTGCCCAGGCTGG - Intronic
1118106226 14:62663120-62663142 GAAAACAAAGTTCCAGGTGCAGG + Intergenic
1119558571 14:75572001-75572023 TACCACAAAGCTGCACATGCAGG + Intergenic
1119888232 14:78162354-78162376 GAACACAAAACTCCCCACGCTGG + Intergenic
1122877673 14:104676449-104676471 AAACACAAGGTTCAACAAGCGGG - Intergenic
1202873531 14_GL000225v1_random:187753-187775 GAACACCAAGTCCCAGAGGCAGG + Intergenic
1124559454 15:30758288-30758310 GTCCACAAAGTTCCACAGGAGGG - Intronic
1124671796 15:31647430-31647452 GTCCACAAAGTTCCACAGGAGGG + Intronic
1126833700 15:52636820-52636842 GAACACCTAGCTCTACATGCAGG - Intronic
1127152815 15:56095620-56095642 GACCAAAAGGTTCCACATTCAGG - Exonic
1128223314 15:65983660-65983682 GCACTGAAAGTTCCACATTCTGG + Intronic
1131129591 15:89888436-89888458 GGACACAAGGTTCTACAGGCTGG + Intronic
1131494615 15:92895100-92895122 GAACATAAAGTTGAACATGGAGG - Intronic
1131570283 15:93527988-93528010 GAAGTCCAAGATCCACATGCTGG - Intergenic
1131922950 15:97350175-97350197 GAACAAAAAGTTCCATGTCCTGG - Intergenic
1134366706 16:13585606-13585628 TCACCCAAAGTTCCACATGCTGG + Intergenic
1138447487 16:57073510-57073532 GCACCCAAAGTCCCACATCCAGG + Intronic
1139139625 16:64245338-64245360 GAAAACAAAGTTCAACAAGTGGG + Intergenic
1140674840 16:77317709-77317731 GAACACAAACTCCCACACACTGG + Intronic
1141127811 16:81413561-81413583 GCACAGAAAGTCCCACATCCTGG - Intergenic
1141864315 16:86739791-86739813 GAACATAAAGTGCCACAGACCGG + Intergenic
1144868979 17:18356756-18356778 GAACCAGAAGTTCCACATGGTGG - Intronic
1146653423 17:34621193-34621215 CATGACAAAGTTCCACAGGCTGG + Intronic
1147569945 17:41563635-41563657 AAACACAAATTGCCACAGGCTGG - Intergenic
1148253379 17:46106169-46106191 GAACACTGAGTTCCAAATCCTGG + Intronic
1148465510 17:47862748-47862770 CAACAGGAAGTCCCACATGCTGG - Intergenic
1151453943 17:74215056-74215078 GAACACAGACTCCCACAGGCTGG - Intronic
1155691581 18:28631071-28631093 GGACTCAAAGTTCCACATGGTGG - Intergenic
1158383208 18:56958934-56958956 AAACACAAAGTCCCAGATGGAGG + Intronic
1158904640 18:62000404-62000426 GAACTTACAGTTCCACATGCTGG - Intergenic
1162109281 19:8391334-8391356 CAACCCAAAGTCCCAGATGCTGG - Intronic
1163123511 19:15232125-15232147 GAACACCAGGCTCCACATGAAGG + Exonic
1165261098 19:34618701-34618723 GAAGAAAGAGTTTCACATGCAGG - Intronic
1166659407 19:44636379-44636401 GAACTGTAAATTCCACATGCAGG - Intronic
1168648770 19:58079408-58079430 GATCACAAAATACCACAGGCTGG + Intronic
926291044 2:11530737-11530759 GAACACCATGCACCACATGCAGG - Intergenic
927015313 2:18953234-18953256 GCACACACATTTCCACATGCGGG - Intergenic
929595374 2:43172184-43172206 AGACACAAATTTGCACATGCTGG + Intergenic
929970619 2:46571901-46571923 GAACACCCAGGTCCACATGAAGG + Intronic
930301865 2:49626747-49626769 AATCACAAATTTCCAAATGCTGG + Intergenic
932435425 2:71700350-71700372 GCACACAGTGTTCCACCTGCAGG + Intergenic
935847507 2:107182699-107182721 GAACTCACAGTTCCACAAGAGGG + Intergenic
935998797 2:108803599-108803621 GAACAAAAACTTCCACTAGCTGG - Intronic
939853396 2:147327125-147327147 TAAAATAAAGTTCCACATACAGG - Intergenic
943155553 2:184170437-184170459 GAAAACCAAATACCACATGCGGG + Intergenic
943768186 2:191685631-191685653 GAACACCAGTTTTCACATGCTGG + Exonic
945395088 2:209307159-209307181 AAACCTACAGTTCCACATGCAGG + Intergenic
945643418 2:212460168-212460190 GGACTTACAGTTCCACATGCTGG - Intronic
946113035 2:217437036-217437058 GCACACACATATCCACATGCAGG + Intronic
946222774 2:218242936-218242958 AAAAACAAACTTCCACATGGTGG - Intronic
946499903 2:220236461-220236483 CAAAACAAAGTACCACATACTGG + Intergenic
1173989860 20:47293664-47293686 GAGCACAAAGCTCCCCTTGCTGG + Intronic
1174466551 20:50722156-50722178 GTTCACAAAGTACCACACGCTGG - Intergenic
1177553445 21:22656824-22656846 AAACACAAATATCCACATGGAGG + Intergenic
1180284573 22:10731848-10731870 GAACACCAAGTCCCAGAGGCAGG - Intergenic
1181804678 22:25367580-25367602 GAGCACCTAGTTCCACTTGCGGG - Intronic
1182086437 22:27564221-27564243 GAACACAAAGTGCCTCATCCTGG + Intergenic
1182731033 22:32493768-32493790 GAAAAAAAAGTTCCACAATCAGG - Intronic
1184418125 22:44363906-44363928 GAACACCAAGGTCCAGAGGCAGG + Intergenic
949390804 3:3560025-3560047 GATGACAAAGATCCACATTCAGG + Intergenic
951226394 3:20126111-20126133 GAACAGAAAGTACCACTTACGGG - Exonic
952322254 3:32288974-32288996 AGACACAAAGTACCACATGGTGG - Intronic
952698613 3:36300162-36300184 GAACACCATGTACCACATGCAGG - Intergenic
953156121 3:40375687-40375709 GGACTCATAGTTCCACATGGTGG - Intergenic
954010917 3:47637413-47637435 GAACACAAAGGCCCAGAGGCTGG + Intronic
954130555 3:48558609-48558631 GATTCCAAAGGTCCACATGCTGG + Intronic
956074812 3:65493676-65493698 AAACAGGAAGTTCCACATCCAGG + Intronic
956288961 3:67641725-67641747 GCATACAAAGTACCACATACTGG + Intronic
956933856 3:74077273-74077295 GATCAGAAAGTACCACAGGCTGG - Intergenic
957084882 3:75669630-75669652 GAACACAAAGTCCCGAGTGCCGG - Intergenic
957114103 3:76002630-76002652 GAACTCACAGTTCCACGTGCTGG - Intronic
960122205 3:113958380-113958402 GATCACAGAGTACCACACGCAGG - Exonic
961699888 3:128735037-128735059 GAACACATAGTTCATCATTCAGG - Intronic
963627187 3:147688650-147688672 GGACTCACAGTTCCACATGGCGG + Intergenic
964311466 3:155398167-155398189 GAAAAGAAAGTTACACATTCTGG + Intronic
967607448 3:191464894-191464916 TGACTCACAGTTCCACATGCTGG + Intergenic
969049434 4:4362280-4362302 GGACTCACAGTTCCACATGGCGG + Intronic
971454552 4:26832053-26832075 CAACAAATATTTCCACATGCTGG + Intergenic
973183101 4:47292276-47292298 GGACTTACAGTTCCACATGCTGG - Intronic
974445587 4:61976772-61976794 GGACTCACAGTTCCACTTGCAGG - Intronic
974755763 4:66205151-66205173 GAACACACATTCCCAAATGCAGG + Intergenic
975854904 4:78614026-78614048 AAACACAAGGTTTCACAGGCAGG - Intergenic
975874522 4:78820384-78820406 GAACAAAAAGATCCACATCAAGG - Intronic
975995146 4:80304691-80304713 GAACACACAGTCAAACATGCTGG + Intronic
976301097 4:83516305-83516327 GAGCACAAAGTTGCACAAACAGG + Intronic
977464995 4:97372923-97372945 GGACTCACAGTTCCACATGGTGG + Intronic
979864300 4:125734197-125734219 GAACACTAAATTTCACATACAGG - Intergenic
980287262 4:130796375-130796397 GAAAAAACAGTTCCAAATGCAGG - Intergenic
980293237 4:130871583-130871605 TGACTCACAGTTCCACATGCAGG - Intergenic
981183780 4:141777563-141777585 GAAAACAAAGTTCCTCTTTCTGG - Intergenic
984983692 4:185307063-185307085 TAACACAAAGGGCCACAGGCAGG - Intronic
986106742 5:4667061-4667083 TAACTCACAGTTCCACAGGCTGG + Intergenic
986215999 5:5719805-5719827 GATAACAAAGTGCCACAGGCCGG + Intergenic
986715869 5:10523287-10523309 GCACTCACAGTTCCACATGGTGG + Intergenic
986911023 5:12557007-12557029 GAAAACAAAATTCCAGATACTGG - Intergenic
987549871 5:19365674-19365696 GAACAGGAACTTCCACATTCAGG + Intergenic
988011296 5:25489594-25489616 CAACACAGAGGTCCAAATGCTGG + Intergenic
988862430 5:35297440-35297462 CAAAACAAAGTTTCACAGGCTGG + Intergenic
990063795 5:51686588-51686610 TAGCACAAAGTTACACCTGCAGG + Intergenic
990115516 5:52385623-52385645 GAACACAAGCTTCCACACCCTGG + Intergenic
990992929 5:61702746-61702768 GAACACAAAATTGCACAGGGAGG - Intronic
991481017 5:67079842-67079864 GAACACAAAGTTCCACATGCTGG + Intronic
991943585 5:71878631-71878653 AGACAAAAAGTTCCAAATGCTGG - Intergenic
991962183 5:72056168-72056190 GAAGACAAAGTGCTACATTCAGG - Intergenic
992289359 5:75269263-75269285 CAAGACAAAGTTCCATATGGTGG + Intergenic
994100622 5:95888118-95888140 GAGCACACACTTCCAGATGCTGG + Exonic
995392961 5:111659874-111659896 GGACTCACAGTTCCACAGGCTGG + Intergenic
996627678 5:125589340-125589362 GGACTCATAGTTCCACATGGTGG + Intergenic
997817741 5:137034899-137034921 GAACACAAAAGGGCACATGCGGG + Intronic
999652827 5:153784208-153784230 GCACCCAAAGTTCCACATCCTGG - Intronic
999732999 5:154490046-154490068 GGACACAAAATTCAACACGCTGG + Intergenic
999829236 5:155303348-155303370 GAACACAGAGTTTCCCTTGCTGG - Intergenic
1000400851 5:160825492-160825514 GGACTCACAGTTCCACATGCTGG - Intronic
1003016244 6:2469683-2469705 GTACACACACGTCCACATGCAGG - Intergenic
1004435195 6:15585699-15585721 GAAAATAAAGTTCCACCTACAGG + Intronic
1005220361 6:23580241-23580263 GAATTGAAAGTTCCACATCCTGG + Intergenic
1005873166 6:29992437-29992459 CATAACAAAGTACCACATGCTGG - Intergenic
1006448295 6:34091953-34091975 GGACACATAGTTCCACTTGAGGG + Exonic
1009057486 6:58354737-58354759 GAACACTTAGTTTCACATGAAGG - Intergenic
1009233326 6:61092342-61092364 GAACACTTAGTTTCACATGAAGG + Intergenic
1009306152 6:62091714-62091736 GAGAAAAAAGTTACACATGCTGG + Intronic
1009559398 6:65220539-65220561 GGACTCACAGTTCCGCATGCTGG - Intronic
1009559655 6:65222489-65222511 GGACTCACAGTTCCACATGCTGG - Intronic
1011124607 6:83993585-83993607 GAACACAAATTTCCACATCTAGG + Intergenic
1013087416 6:106868225-106868247 GAGCACCAAGTTCCACGTGTTGG - Intergenic
1013337904 6:109183859-109183881 ATAGACAAAGTTCAACATGCTGG + Intergenic
1013415651 6:109922181-109922203 AAACACAAAGTTCTACATTTAGG + Intergenic
1013960889 6:115898799-115898821 CAGAACAAAGTACCACATGCTGG + Intergenic
1014078048 6:117259561-117259583 GGACACAAAATTCCACAAACAGG - Intergenic
1014177544 6:118347144-118347166 GAACAGAAAGTTCCATATCCAGG - Intergenic
1015821832 6:137269640-137269662 GAACACACAGATCCACTTGAAGG - Intergenic
1017561271 6:155631208-155631230 GGACTCACAGTTCCACATGGCGG + Intergenic
1017619209 6:156277976-156277998 GGACTTACAGTTCCACATGCTGG - Intergenic
1018059298 6:160078223-160078245 GAACACAAAGTCGCACTCGCTGG - Exonic
1018184241 6:161252054-161252076 GAACACTAAGTTCCATAAGTGGG + Intronic
1018410612 6:163542833-163542855 GACGACAAATTTCCACCTGCGGG + Intronic
1019136201 6:169909581-169909603 CAAAACAAGGGTCCACATGCAGG - Intergenic
1019492208 7:1320899-1320921 GCACACACATGTCCACATGCAGG - Intergenic
1021043297 7:15890253-15890275 GAACACATACTCCCACAAGCAGG + Intergenic
1021754554 7:23839121-23839143 CAACACAAACTTCCAGATGCTGG + Intergenic
1023282862 7:38589827-38589849 GAACACAAAATTGCAAATGTTGG + Intronic
1024254979 7:47533871-47533893 GGACTCACAGTTCCACGTGCTGG - Intronic
1025165109 7:56705523-56705545 GAACCTAAAATTCCACATGCTGG + Intergenic
1025240647 7:57269290-57269312 TAACCTAAAATTCCACATGCTGG - Intergenic
1025612864 7:63093556-63093578 TAACCTAAAATTCCACATGCTGG + Intergenic
1025705186 7:63856591-63856613 TAACCTAAAATTCCACATGCTGG - Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028249151 7:88520095-88520117 GAACACAAAATTCCATTTGCTGG + Intergenic
1029981413 7:104882936-104882958 GCACTGAAAGTTCTACATGCGGG - Intronic
1032211357 7:129917201-129917223 AAACAAAAAGTTCCATTTGCTGG + Intronic
1032555616 7:132830571-132830593 GAACACAAAATTCCTCAGGCAGG - Intronic
1033932932 7:146546674-146546696 GGACTCACAGTTCCACATGAGGG + Intronic
1034227241 7:149493725-149493747 GAACAGAAAGGTCCACATCCCGG + Intronic
1035162084 7:156958637-156958659 GACCACACAGACCCACATGCAGG + Intronic
1036043171 8:5109281-5109303 GAACACAAACTCCCACTTGTTGG - Intergenic
1036514610 8:9432260-9432282 GAACACAAAGAGCCACGTGTGGG + Intergenic
1036962815 8:13264372-13264394 GAACATAAAGTTCCTTATTCTGG - Intronic
1036990499 8:13587349-13587371 TAAAACAAAGTTCCAGATGGAGG - Intergenic
1038521976 8:28241756-28241778 CATCACAAAGTACCACATACTGG - Intergenic
1038738905 8:30199322-30199344 TGACTCACAGTTCCACATGCTGG + Intergenic
1038964678 8:32558547-32558569 AAACACACAGGTCCAAATGCAGG - Intronic
1039273657 8:35910964-35910986 GGACTCACAGTTCCACAGGCTGG + Intergenic
1039747971 8:40448994-40449016 TAACACAAACTTCCACATAGTGG + Intergenic
1040759144 8:50816923-50816945 AATAACAAAGTACCACATGCTGG - Intergenic
1040945172 8:52876767-52876789 TGACTCACAGTTCCACATGCTGG + Intergenic
1041348664 8:56927400-56927422 GAACACAGAATTCCACATGGAGG + Intergenic
1041416908 8:57620574-57620596 GAACACAAATTCTCACAGGCTGG + Intergenic
1043148963 8:76689149-76689171 GAACAAAAAAATCCACATGGAGG + Intronic
1043749738 8:83920987-83921009 GGACTCACAGTTCCACGTGCTGG + Intergenic
1045730576 8:105234595-105234617 TGACTCAAAGTTCCACATGGAGG - Intronic
1046141207 8:110095093-110095115 GACCACAAAGTACCACAAGATGG - Intergenic
1046822896 8:118653511-118653533 CATAACAAAGTTCCACAAGCTGG + Intergenic
1048457573 8:134591929-134591951 GCAATCAAAGTGCCACATGCTGG - Intronic
1052712532 9:32074555-32074577 GACCACATAGTGGCACATGCTGG - Intergenic
1055820709 9:80259003-80259025 GAACACATTGTTCCACTTGATGG - Intergenic
1056893165 9:90515064-90515086 GATCACAAAATACCACAGGCTGG + Intergenic
1057340534 9:94197651-94197673 GAACAAAAAAATCCAGATGCAGG - Intergenic
1057750690 9:97790368-97790390 GCACTGAAAGTTCCACATCCTGG - Intergenic
1058207092 9:102121938-102121960 GCATGGAAAGTTCCACATGCTGG + Intergenic
1058637746 9:107053066-107053088 GAACAGAAACTTCCAGATGGTGG - Intergenic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1061955797 9:133960713-133960735 GCAGACAAAGCGCCACATGCCGG - Intronic
1203730928 Un_GL000216v2:88784-88806 GAACACCAAGTCCCAGAGGCAGG - Intergenic
1185729931 X:2453231-2453253 GAACACAAAATTTCAGTTGCTGG + Intronic
1186504416 X:10079380-10079402 GGACACAAAGTTTCATGTGCGGG + Intronic
1187549685 X:20289716-20289738 GAACACAGATTTTAACATGCTGG + Intergenic
1188576918 X:31662857-31662879 GAACAAAAAGTTCTACATGTTGG + Intronic
1189186746 X:39061479-39061501 GAAAACAAATTTCAACATGGAGG - Intergenic
1190214877 X:48473526-48473548 GAAAGCAAAGTCCCACTTGCTGG + Intergenic
1190372846 X:49759466-49759488 GAACTCACAGTTCCACAGGCTGG + Intergenic
1190637520 X:52450878-52450900 GAACACAAATTCCCACATCCAGG + Intergenic
1190648516 X:52545391-52545413 GAACACAAATTCCCACATCCAGG - Intergenic
1190999670 X:55646643-55646665 GAACACAATGTTCCCCAGGAGGG - Intergenic
1194828803 X:98596060-98596082 GGACTTACAGTTCCACATGCTGG + Intergenic
1194840100 X:98729210-98729232 GAACTCAAAGTTCCACATGGTGG - Intergenic
1195816922 X:108897716-108897738 TGACTCACAGTTCCACATGCTGG - Intergenic
1195881022 X:109592767-109592789 GAACAGAAAGTGACACATCCAGG - Intergenic
1198847989 X:140933592-140933614 GCAAACAAAGTTCCACAGGAAGG - Intergenic
1199879864 X:151965466-151965488 GAACAGCAAGTACCACAAGCAGG + Intronic
1200338053 X:155373091-155373113 GAACTCAAAGAACCACATGGTGG + Intergenic
1200348416 X:155467603-155467625 GAACTCAAAGAACCACATGGTGG - Intergenic
1201453885 Y:14147173-14147195 GGACTCACAGTTCCACATGGTGG + Intergenic