ID: 991484740

View in Genome Browser
Species Human (GRCh38)
Location 5:67123220-67123242
Sequence CCTCAAAAACTGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991484733_991484740 19 Left 991484733 5:67123178-67123200 CCACTCACATCAGTGGCTCAGAG 0: 1
1: 0
2: 4
3: 116
4: 1090
Right 991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 189
991484734_991484740 -9 Left 991484734 5:67123206-67123228 CCAATTCCATGACTCCTCAAAAA 0: 1
1: 0
2: 0
3: 24
4: 223
Right 991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991484740 Original CRISPR CCTCAAAAACTGGTGGAGCT GGG Intronic
900873218 1:5321220-5321242 CCTCAAGTACTGGTGGCCCTTGG - Intergenic
901191107 1:7410284-7410306 CCCCAAAAACTGGTGGACATGGG + Intronic
905056653 1:35100504-35100526 CCTCAGTCACTGGTGTAGCTGGG - Intronic
905079296 1:35303022-35303044 CCTCAACCTCTGGTGGAGCTAGG - Intronic
906503930 1:46363231-46363253 ACTCAAAATCAGGTGAAGCTAGG + Intronic
907214887 1:52854229-52854251 CCTCAAAATCTGTAGGAGATTGG - Intronic
910075718 1:83276195-83276217 CCACAGAAACTGGTGGGGCTGGG - Intergenic
910366703 1:86473161-86473183 CCACAAAAAGTGGTGCAGCCAGG + Intronic
912554788 1:110508198-110508220 CCTCAGCAGCTGGTGGAGCTGGG + Intergenic
914426098 1:147578303-147578325 GCTCAAAAACTTTTGGATCTTGG - Intronic
914709961 1:150204067-150204089 CCTCAACATCTGGAGTAGCTGGG - Intergenic
918093375 1:181316055-181316077 CCTCAGAATCTGCTGGAGCTCGG - Intergenic
921225797 1:213017639-213017661 CCTCAAATTCTGGAGTAGCTGGG - Intergenic
922181009 1:223232882-223232904 TCTCAACAACTGGAGGAGTTGGG - Intronic
924009706 1:239651607-239651629 CCTCAGAAAGTGCTGGAGGTAGG - Intronic
1066058950 10:31705800-31705822 ACTCAAGAGCTGGTGGAGGTTGG - Intergenic
1067082868 10:43221481-43221503 TCTGGGAAACTGGTGGAGCTGGG + Intronic
1068701284 10:60022880-60022902 CTTCAAAATCTGGCAGAGCTGGG + Intergenic
1069860376 10:71467509-71467531 CCTCACAGGCTGGTGGTGCTGGG - Intronic
1072706443 10:97684456-97684478 CCTCAAAATCTGGAGGTGCTAGG - Intronic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1077748599 11:4937494-4937516 CCTGGCAAACTGGTGGAGCATGG + Intronic
1078183118 11:9029042-9029064 CCCCCTAAACTGGAGGAGCTTGG - Intronic
1079661922 11:23049011-23049033 CCTCTAAAACTGGTGGAACAAGG - Intergenic
1081934069 11:46892863-46892885 CCTCAAAGTGTGGTGTAGCTGGG - Intronic
1084420417 11:69057916-69057938 CCTCAAAAACAGGGCGAGCCAGG - Intronic
1085378974 11:76095251-76095273 GCTCAAGAACTGGTGGCCCTAGG - Intronic
1086368596 11:86133719-86133741 CATCAACAAATGGAGGAGCTGGG - Intergenic
1089059166 11:115612189-115612211 CCCCAAGACCTGCTGGAGCTGGG - Intergenic
1089377642 11:118005859-118005881 CCCCCAGAACTGGAGGAGCTGGG + Intergenic
1089679027 11:120109234-120109256 CCTCACAGGCTGTTGGAGCTGGG + Intergenic
1089751809 11:120656871-120656893 CCCCAAAGACTGGTGGATCCTGG - Intronic
1090457770 11:126864780-126864802 CCTCTAAAGCTGATGGAGCTAGG + Intronic
1092401412 12:8181800-8181822 CCTGAAAAACTGGTGGGTATTGG + Intronic
1093450595 12:19308944-19308966 CCTCAGAATCTGGAGTAGCTGGG - Intronic
1097362558 12:58673962-58673984 TCTCAAAAGCGGGTGGAGATAGG - Intronic
1099333193 12:81318162-81318184 CCTCAAAGACTGGTAGAAATAGG - Intronic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1102983456 12:117260426-117260448 CATGAGAAGCTGGTGGAGCTAGG + Intronic
1103086384 12:118063939-118063961 TCTCAAACCCTGGTGGAGCCTGG - Exonic
1104182745 12:126398518-126398540 CCTTAAAGACAGGTGGAGATGGG - Intergenic
1105561207 13:21492580-21492602 TCTTAAAACCTGGTGTAGCTGGG - Intergenic
1106420617 13:29582596-29582618 CCTCCAAAACTGCTGGAACCTGG - Intronic
1106997039 13:35496765-35496787 CCTTAATAACTGGAGCAGCTTGG + Intronic
1107463493 13:40628094-40628116 TGTCAAAAACTGGTGAATCTGGG + Intronic
1111533630 13:89573260-89573282 CCTCAAAAACTAATGCAGATGGG + Intergenic
1111871873 13:93843531-93843553 GATTAAAAACTGGTGGACCTTGG + Intronic
1113419464 13:110159252-110159274 GAGCAAAAACTGGTGGAACTGGG + Intronic
1116657826 14:47674211-47674233 AATCAAAGACTGCTGGAGCTCGG + Intronic
1117758034 14:58996818-58996840 CCTCCTAAAGTGGTGGTGCTGGG + Intergenic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1119888808 14:78167027-78167049 GGCCAAAAAATGGTGGAGCTGGG + Intergenic
1122175771 14:99917556-99917578 CCTCAAAAAAGGGTGGGGGTAGG + Intronic
1124498661 15:30206951-30206973 CCTACAAAGCTGGGGGAGCTGGG + Intergenic
1124744920 15:32331725-32331747 CCTACAAAGCTGGGGGAGCTGGG - Intergenic
1125770067 15:42159329-42159351 CCACTAAAACTGTTGGTGCTGGG + Exonic
1126419917 15:48460792-48460814 ACTGAAAAACTGGTGAAGGTTGG - Intronic
1126904557 15:53350375-53350397 CCTCAATAAATGGTGGACTTTGG + Intergenic
1128606602 15:69040978-69041000 CTTCAAGAACTGGTGAAGGTGGG - Intronic
1130934458 15:88456906-88456928 CCTCAAAAAGTTTTGGAGTTTGG - Intergenic
1131182653 15:90250947-90250969 CTTCAACATCTGGAGGAGCTGGG + Intronic
1136170485 16:28486448-28486470 CCTCAGGGACTGGGGGAGCTGGG - Exonic
1137424667 16:48367472-48367494 GCTCAACAACTGGTGGAGCCGGG - Intronic
1139052640 16:63145131-63145153 CCTTACAAAATGGTGCAGCTTGG - Intergenic
1139240487 16:65386744-65386766 CCTCAAAAACTTCAGGGGCTAGG + Intergenic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1141822736 16:86458527-86458549 ACTGAAAAAGTGGTGAAGCTAGG - Intergenic
1145888983 17:28401768-28401790 ACTCAGTAAATGGTGGAGCTAGG - Exonic
1146258147 17:31403700-31403722 CTTGAGTAACTGGTGGAGCTGGG + Intronic
1146339114 17:32004875-32004897 ACTCAAAAACTTTTGGACCTTGG - Intergenic
1150134016 17:62685570-62685592 TCTCAAAAACTGCTGGAGTATGG + Intronic
1150751311 17:67865174-67865196 ACTCAAAAACTTTTGGATCTTGG + Intronic
1152052875 17:77995955-77995977 CCTCAGAATCTTGTGTAGCTGGG - Intergenic
1158109040 18:53919494-53919516 ACACAAAAACTGGTGTAGCTGGG + Intergenic
1159467217 18:68799680-68799702 CTTGAAAAACTAGTGGAACTTGG + Intronic
1160596520 18:79979051-79979073 CCTCAAACTCTCGTGTAGCTGGG + Intronic
1164644684 19:29849778-29849800 CCTCAAAGCCAGGTGGGGCTGGG - Intergenic
1168060116 19:53886792-53886814 AACCAAAAAGTGGTGGAGCTGGG - Intronic
1168518292 19:57026998-57027020 CCTCAAACACCTGAGGAGCTGGG + Intergenic
925412584 2:3648494-3648516 CCTCCAGGACTGGTGGACCTGGG - Intergenic
925841660 2:7997779-7997801 CCTCATAAACTGACAGAGCTGGG + Intergenic
926386872 2:12343995-12344017 CCTCAGAATCTGGAGTAGCTAGG + Intergenic
927231576 2:20829312-20829334 CCTCAACCACTGGAGTAGCTGGG + Intergenic
927231600 2:20829448-20829470 CCTCAACCACTGGAGTAGCTGGG + Intergenic
927266434 2:21157799-21157821 CCTAAAGAACTGGGGGTGCTTGG - Intergenic
930169876 2:48240466-48240488 GCTCAAAATCAGGTGGAGGTGGG + Intergenic
931104836 2:59043846-59043868 CCTGAAAAAAGGGTGGAGCGTGG - Intergenic
931381280 2:61755762-61755784 CTTTAAAAACTGGTGTACCTGGG + Intergenic
932749537 2:74362594-74362616 CAGCATAAACTGGTGGAGCCAGG - Intronic
934031319 2:88050323-88050345 TCTTAAAAACAGGTAGAGCTGGG + Intronic
935097335 2:99958189-99958211 CCTCAAAAACTGGGGGATACAGG + Intronic
936050397 2:109218172-109218194 CCTCAGAAACTGGTGAGGCCAGG - Intronic
938710255 2:133970602-133970624 CCTCAGAAAATGGTCAAGCTTGG - Intergenic
939830777 2:147068126-147068148 CCACAGAAACTTGTGGAGTTGGG + Intergenic
942047367 2:172107703-172107725 CCTCCAAAAGTGCTGGGGCTGGG + Intergenic
942093387 2:172515563-172515585 CCTCAAAGTGGGGTGGAGCTAGG - Intergenic
942393062 2:175516507-175516529 CCTCCATTACTGGAGGAGCTGGG + Intergenic
944038961 2:195333476-195333498 TCTCCAAAATTGGTGGAGGTGGG - Intergenic
947448210 2:230180819-230180841 TCTCAAACACTGGTGGAGGCAGG - Intronic
1168899076 20:1344978-1345000 CCTCAAGACCTGCGGGAGCTGGG + Intronic
1171128816 20:22629128-22629150 CCTCAAAAATTGCAGGGGCTGGG + Intergenic
1174483150 20:50845179-50845201 ACCCAGAAAATGGTGGAGCTGGG + Intronic
1174614780 20:51827461-51827483 CCTCTAGAACTGCAGGAGCTGGG + Intergenic
1174764470 20:53239446-53239468 GCTCAAAAACTCCTGGTGCTGGG + Intronic
1177876665 21:26641380-26641402 CACCAAAGACTTGTGGAGCTGGG - Intergenic
1178361014 21:31948567-31948589 CCTCAGCACCTGGTGGAACTTGG + Intronic
1178473956 21:32920119-32920141 CCTCAGCCACTGGTGTAGCTGGG + Intergenic
1180625145 22:17189415-17189437 CTTCAAAAACTGGTGTGGCCAGG + Intronic
1182430563 22:30296371-30296393 GCTAGAAAAATGGTGGAGCTGGG + Intronic
1183771515 22:39930338-39930360 TATCAAAAAATGGTGGAGCCAGG - Intronic
1184375711 22:44111305-44111327 GCTAAAACTCTGGTGGAGCTGGG + Intronic
1184805807 22:46794198-46794220 CATCACAAGCTGGTGGAGTTAGG - Intronic
949731359 3:7117129-7117151 CCTCAAAGAGTGGAGGAGATGGG + Intronic
950527423 3:13532625-13532647 GCCCCAAAACTGGTGGTGCTTGG - Intergenic
952179530 3:30902991-30903013 CATCAAAAGATGGAGGAGCTAGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952287927 3:31985941-31985963 CCCCAAATTCTGGTGGAGCCAGG + Intronic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
955723348 3:61906662-61906684 CCTCAACATCTAGAGGAGCTGGG - Intronic
960512223 3:118564380-118564402 TTTCCAAAACAGGTGGAGCTGGG + Intergenic
961149581 3:124625963-124625985 CCTCAACCTCTGGTGTAGCTGGG - Intronic
961698751 3:128725726-128725748 ACACAGAAACTGGTGGAGCGAGG - Intergenic
963843443 3:150131080-150131102 GCCCAAGAACTGGTGGAACTGGG + Intergenic
965132116 3:164714472-164714494 CCTCATAAACAGGTGCAGTTTGG - Intergenic
966494905 3:180568849-180568871 TATCAAAAAATGATGGAGCTCGG - Intergenic
967277001 3:187785879-187785901 CCTCAAAAACTTTTGGATTTTGG - Intergenic
968022109 3:195401549-195401571 CCTCAGCAACCGGTGTAGCTGGG - Intronic
970633019 4:17974671-17974693 ACTCAAAAAATGGTGAAGTTTGG - Intronic
970653470 4:18203447-18203469 CCTCAAATACTGCTGAGGCTAGG - Intergenic
974303705 4:60104123-60104145 CCAAAAAAAGTGGTGAAGCTGGG - Intergenic
974795196 4:66739918-66739940 CCTGAAAAATTGGTAAAGCTTGG + Intergenic
977076519 4:92458511-92458533 ACACAAAAAATGGTGGAGCCTGG - Intronic
977535100 4:98248443-98248465 CCTCAAAAAATTCTGGATCTAGG + Intergenic
978897230 4:113903571-113903593 CCTCAGAAACTGAAGGAGGTTGG - Exonic
981505874 4:145499213-145499235 CCTCAAAAAGTTTTGGATCTTGG - Intronic
981845248 4:149160454-149160476 ACACAGAAACTGGTGGAGCTAGG - Intergenic
984134613 4:175920052-175920074 CCTCTAAAGGTGATGGAGCTTGG + Intronic
984794290 4:183644036-183644058 TCTTAAAAACTTCTGGAGCTAGG + Intronic
990420455 5:55626947-55626969 CCTCAGAAACATCTGGAGCTAGG + Intronic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
992682288 5:79165168-79165190 CCTCAACCTCTGGTGTAGCTGGG - Intronic
993131184 5:83900211-83900233 GCTCAAAGACTGGTGGGGCTTGG + Intergenic
993827911 5:92715422-92715444 CCTCACACACTGGGGGAGGTAGG - Intergenic
994515877 5:100772527-100772549 ATGCAGAAACTGGTGGAGCTAGG - Intergenic
996627855 5:125591144-125591166 CCACAAAGACTAGTGGAGGTGGG + Intergenic
996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG + Intergenic
997001526 5:129767684-129767706 ACTTAAGAACTGGTGGAGCCAGG - Intergenic
1000637340 5:163659363-163659385 CCTCAGAGACTGGAGGAGGTTGG + Intergenic
1001686152 5:173596491-173596513 CCTCACAAGATGGAGGAGCTGGG - Intergenic
1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG + Intergenic
1002114558 5:176948739-176948761 ATTCAAAACATGGTGGAGCTGGG + Intronic
1003733118 6:8848406-8848428 CTCCAAAAACAGGTGGATCTTGG - Intergenic
1005367074 6:25089340-25089362 TCTCATAAACTGGTGAAGCTGGG - Intergenic
1005839433 6:29732078-29732100 CCTCAAACACTGGGGTACCTAGG + Intronic
1006019362 6:31108768-31108790 GCTTAAAAAATGGTGGAACTGGG - Intergenic
1006127128 6:31846241-31846263 CCTTAAAAACTTTTGGGGCTGGG + Intergenic
1006851767 6:37103495-37103517 CCCCACAAACAGGTGCAGCTGGG - Intergenic
1013030473 6:106327583-106327605 CCTCAACCACTGGAGTAGCTGGG - Intergenic
1013244431 6:108273401-108273423 CTTCAAAACCTGGTTGAGCATGG + Intergenic
1013673685 6:112433494-112433516 CCTCAAAACCAGGTTGAGGTTGG + Intergenic
1017220379 6:151959548-151959570 CCTCAAAAGCTGGTGGAGGTAGG - Intronic
1017325795 6:153140185-153140207 CCTCTTATACTGGTGCAGCTCGG + Intergenic
1020147690 7:5657265-5657287 CCTCAAAAAATGGTGAGACTGGG + Intronic
1020851062 7:13352827-13352849 CCTCGAAAACTGGTGGAAGAAGG - Intergenic
1021414383 7:20365414-20365436 CATTAGAAACTGGTGGAACTAGG - Intronic
1024123914 7:46272259-46272281 CCTCAAACTCTGGAGCAGCTGGG - Intergenic
1024896751 7:54269387-54269409 CCTCTTAAACAGGTGGTGCTGGG - Intergenic
1027293431 7:76741069-76741091 CCACAGAAACTGGTGGGGCTGGG - Intergenic
1028280041 7:88913508-88913530 CCTCAACCTCTGGAGGAGCTGGG + Intronic
1032715950 7:134509638-134509660 CCTGAAAAAGTGCTGGACCTAGG - Intergenic
1036751841 8:11448610-11448632 CCTGAAAATCTGGGGGAGGTGGG - Intronic
1037515486 8:19627320-19627342 TCTCAAAAACTGACGGAGCATGG + Intronic
1037865605 8:22440582-22440604 CCACAAAAACTGAAGGAGCGCGG + Intergenic
1038251027 8:25904415-25904437 CCCCAAACACTGGTGGAACCTGG - Intronic
1038573700 8:28685721-28685743 CATCAAAAACTGGTGAATCTGGG - Intronic
1039090621 8:33825279-33825301 CCTGATAAACTGCTGGATCTAGG + Intergenic
1039153822 8:34533127-34533149 CCTCAGAAACTTGTGCAGTTGGG + Intergenic
1039436844 8:37565226-37565248 CCTCAAACAATGGTGGAGGGAGG - Intergenic
1039700006 8:39952546-39952568 CCACAATAAATGTTGGAGCTTGG - Intronic
1041309363 8:56498841-56498863 CCTAAAAAACTGATGGGCCTGGG + Intergenic
1044235689 8:89827313-89827335 ACTCAAAAACTAATGGAGCTGGG - Intergenic
1044662601 8:94606043-94606065 CCTCAAACACTAGAGTAGCTGGG + Intergenic
1044715508 8:95096027-95096049 ACTTAAAAACTGAAGGAGCTAGG - Intronic
1045009188 8:97943151-97943173 CCTAAAGAACTGGGGGAGCCTGG + Intronic
1047044244 8:121034035-121034057 CCTGAACAAATGGAGGAGCTGGG - Intergenic
1047732768 8:127739764-127739786 CCTCAAAAATAGGAGGTGCTTGG + Intronic
1049063410 8:140294223-140294245 CCTCAGAAGCTGGTGGGCCTGGG - Intronic
1049916546 9:323377-323399 CCACAAAAACTGGCCGAGCGTGG - Intronic
1055990460 9:82100639-82100661 CCTCACAAACAGGTTGAGATCGG - Intergenic
1056310190 9:85332977-85332999 GCTTAAAAACTGGCAGAGCTGGG + Intergenic
1056310374 9:85334767-85334789 GCTTAAAAACTGGCAGAGCTGGG - Intergenic
1058801246 9:108546301-108546323 CCTAAGAAAATGGTGGTGCTGGG - Intergenic
1060269900 9:122132888-122132910 ACTCAAGCCCTGGTGGAGCTGGG - Intergenic
1061011227 9:127955782-127955804 CCTCAAAGCCTTGTGGAGCCTGG - Intronic
1061706899 9:132460246-132460268 CCTCATAAAGTGGAGGAGGTGGG - Intronic
1062539528 9:137035468-137035490 TCTCAGTAACAGGTGGAGCTGGG + Exonic
1186549546 X:10488410-10488432 TCTCACAAACTGCTGGAGGTGGG - Intronic
1186662639 X:11684643-11684665 CCTCAATAACTGAAGGAGATGGG - Intergenic
1189385831 X:40536173-40536195 TCTCAAAAAAAGGTGGAGGTGGG + Intergenic
1192796140 X:74425321-74425343 CCTCCAAAACTGGTGAAGAGAGG - Intronic
1194857654 X:98954082-98954104 CCTCAAAACCTGGTGGTGGAAGG - Intergenic
1195260125 X:103123646-103123668 CCACACAAACTGATGGAGCCCGG + Intergenic
1196138231 X:112232855-112232877 CCTCAAGAAGTGGGGAAGCTGGG - Intergenic
1198325946 X:135573341-135573363 GCTCAGACACTGGTGTAGCTTGG + Intronic
1198951499 X:142077629-142077651 CCTCACAAACTGTGTGAGCTTGG + Intergenic
1199319580 X:146422652-146422674 CCTCACAAACTGTGTGAGCTTGG + Intergenic
1201354471 Y:13082779-13082801 CAGCAAAGCCTGGTGGAGCTGGG - Intergenic