ID: 991486490

View in Genome Browser
Species Human (GRCh38)
Location 5:67142610-67142632
Sequence CTGGACACTTACCGTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991486483_991486490 6 Left 991486483 5:67142581-67142603 CCCGCTGGCCAGATAGTATCCCC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 991486490 5:67142610-67142632 CTGGACACTTACCGTTTTCCAGG 0: 1
1: 1
2: 2
3: 32
4: 146
991486485_991486490 -2 Left 991486485 5:67142589-67142611 CCAGATAGTATCCCCGAACAGCT 0: 1
1: 0
2: 0
3: 4
4: 22
Right 991486490 5:67142610-67142632 CTGGACACTTACCGTTTTCCAGG 0: 1
1: 1
2: 2
3: 32
4: 146
991486484_991486490 5 Left 991486484 5:67142582-67142604 CCGCTGGCCAGATAGTATCCCCG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 991486490 5:67142610-67142632 CTGGACACTTACCGTTTTCCAGG 0: 1
1: 1
2: 2
3: 32
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991486490 Original CRISPR CTGGACACTTACCGTTTTCC AGG Intronic
900436746 1:2634595-2634617 CTGGACACTCACAGATTTGCAGG + Intergenic
900510645 1:3058745-3058767 CTGCACTCTTACCGTGTGCCAGG - Intergenic
901216356 1:7557689-7557711 CTGGGCACCTACCGTGTGCCAGG + Intronic
902733700 1:18386210-18386232 CTGAACACTTACCATGTGCCAGG - Intergenic
902854607 1:19192176-19192198 GTAGACACATACCCTTTTCCAGG + Exonic
903282336 1:22257198-22257220 CTGGACTCCTACCCTGTTCCAGG + Intergenic
904806200 1:33134124-33134146 CTGAACACTTACCGTGGGCCAGG + Intergenic
906443731 1:45874951-45874973 CTTCACACTTACTGTTCTCCTGG - Intronic
911506025 1:98752702-98752724 CTGAGCACTTACCATATTCCTGG + Intronic
912956873 1:114160403-114160425 CTGAGCACTTACTCTTTTCCAGG + Intergenic
919762511 1:201106843-201106865 CTGGGTACTTACTGTTTCCCAGG - Intronic
922676866 1:227558782-227558804 GTGTACAGTTACGGTTTTCCTGG - Intergenic
1065643914 10:27814782-27814804 ATGGACAGTTATGGTTTTCCTGG - Intronic
1071178274 10:82953175-82953197 CTGAACACTTACTCTTTGCCAGG + Intronic
1072170322 10:92853262-92853284 GTGGACACATACTGTTTTCATGG + Intronic
1072473724 10:95738105-95738127 CTGGACACCTACCATATGCCAGG - Intronic
1073672816 10:105610831-105610853 CTGGACACTTACTGTGTGTCAGG + Intergenic
1074526610 10:114268535-114268557 CTGGGCACTTAGCGTGTGCCAGG - Intronic
1074692552 10:116019419-116019441 CTGGGCACTTACTGTGTGCCAGG - Intergenic
1074975587 10:118578745-118578767 CTGGGTACTTACCATTGTCCTGG + Intergenic
1075397064 10:122134974-122134996 CTGGACACTTCCCATGCTCCAGG + Intronic
1076948297 10:133665957-133665979 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076949286 10:133669267-133669289 CCGGACGCTGACCGTTTTCCCGG - Intronic
1076950270 10:133672566-133672588 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076951255 10:133675865-133675887 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076952245 10:133679175-133679197 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076953233 10:133682485-133682507 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076955201 10:133742136-133742158 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076956191 10:133745446-133745468 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076957179 10:133748755-133748777 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076958168 10:133752065-133752087 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076959152 10:133755364-133755386 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1076960141 10:133758674-133758696 CCGGACGCTGACCGTTTTCCCGG - Intergenic
1077800603 11:5532306-5532328 CTGGACATTTACTGTGTTACAGG - Intronic
1078788416 11:14519872-14519894 CTGGACAGCGTCCGTTTTCCTGG - Intronic
1079314245 11:19394418-19394440 CTGGACACTTACTATATTCCAGG + Intronic
1083541255 11:63512858-63512880 GTGGACACTTACCATGTACCAGG - Intronic
1086945265 11:92838554-92838576 CTCTACACTGACAGTTTTCCTGG - Intronic
1087752092 11:102018225-102018247 CTGGATACTTACCATGTGCCAGG + Intergenic
1088495316 11:110426182-110426204 CTGGACACGTTCAGTATTCCAGG + Intergenic
1093044602 12:14427863-14427885 CTGGGCACTTACTGTGTGCCAGG - Intronic
1093908917 12:24724038-24724060 CTGAACACTTACTATTTGCCTGG - Intergenic
1094819054 12:34210932-34210954 CTGGGCGCTTAACATTTTCCAGG + Intergenic
1097100752 12:56587427-56587449 CTGCTCACTTACCATTTCCCAGG + Intronic
1100869674 12:98896346-98896368 CTGAGCACTTACGATTTTCCAGG + Intronic
1101675241 12:106911332-106911354 CTGGACACTTACTGAGTACCAGG + Intergenic
1105842072 13:24262687-24262709 CTGCACACTTACTGTGTGCCAGG - Intronic
1106853433 13:33819915-33819937 TGGGACACTTGCCATTTTCCAGG + Intronic
1108683293 13:52797788-52797810 CTGGACATTTTCCCTCTTCCTGG + Intergenic
1113818990 13:113197914-113197936 CTGTTCACTTACCCTTTTCGTGG - Intronic
1116280882 14:42905317-42905339 CAGGACACTTATTGTTTTCTTGG + Intergenic
1119428375 14:74550469-74550491 CTGGAAACTAAGCGGTTTCCTGG + Intronic
1202921558 14_KI270723v1_random:33535-33557 CCGGACACTTACCGTTTTCCCGG - Intergenic
1202923358 14_KI270724v1_random:4045-4067 CCGGACACTTACGGTTTTCCCGG + Intergenic
1127334171 15:57967346-57967368 CTGCACACTTACTGTGTGCCAGG - Intronic
1129113041 15:73349282-73349304 TTGGACACTTACCATTTGCCAGG + Intronic
1134390180 16:13812685-13812707 CTGTGTACTTACTGTTTTCCAGG - Intergenic
1135621934 16:23963322-23963344 TTGAACGCTTACCGTGTTCCAGG - Intronic
1136268824 16:29136492-29136514 CTGAACACTTCCCACTTTCCTGG + Intergenic
1137957086 16:52842616-52842638 CAGGACACTTACTGTATCCCAGG + Intergenic
1138234834 16:55373511-55373533 CTGGACACATACTTTTTCCCAGG - Intergenic
1138589344 16:57991208-57991230 CTGAGCACCTACCGTTTGCCAGG - Intergenic
1138756528 16:59493051-59493073 CAGGACTCTTAATGTTTTCCTGG + Intergenic
1139215302 16:65121320-65121342 CTGGGGTCTTTCCGTTTTCCCGG + Intronic
1140313065 16:73867673-73867695 GTGGACACCTATCGTTTTTCTGG + Intergenic
1140702085 16:77590229-77590251 TTGGATACTTACTGTGTTCCAGG - Intergenic
1141182949 16:81766738-81766760 CTGAACACTTGCTGTGTTCCAGG - Intronic
1141852686 16:86658235-86658257 CTGAACACGTACCGTGTGCCAGG + Intergenic
1142088414 16:88197047-88197069 TTGGTCACTGACCGTTTTCAGGG + Intergenic
1144198714 17:12919937-12919959 CTGGACACCTAACGTGTACCAGG + Intronic
1146154399 17:30508736-30508758 CTTGACACTTACTGTGTGCCAGG + Intronic
1146620950 17:34397283-34397305 CTGAACACTAATTGTTTTCCAGG + Intergenic
1146834932 17:36103243-36103265 TTGGACACTTACCTTGTACCAGG - Intergenic
1146849541 17:36210478-36210500 TTGGACACTTACCTTGTACCAGG - Intronic
1148165573 17:45482037-45482059 CTGAACACTTACCATTTTCTAGG - Intronic
1150396799 17:64828755-64828777 CTGAACACTTACCATTTTCTGGG - Intergenic
1153059524 18:980936-980958 CTGGACATTTTCCTTGTTCCAGG + Intergenic
1154984851 18:21539908-21539930 CTGGAAATTTACCTTTTTCAGGG + Exonic
1156183839 18:34638806-34638828 TTGATCACTTACTGTTTTCCAGG + Intronic
1157796238 18:50578215-50578237 CTGGCCACTTCCCCTTTTCCAGG - Intronic
1164816649 19:31209335-31209357 CTGGACACTTGCCATTTGCTGGG + Intergenic
1165152770 19:33770727-33770749 CTGGACAATTACCCTCTACCTGG + Intronic
1165527979 19:36372186-36372208 CTGGATACTTACCTTTCCCCAGG - Intronic
1168420318 19:56197722-56197744 CTGGACACTCACCTCCTTCCCGG + Exonic
1168424525 19:56228240-56228262 CTGGACACTCACCTCCTTCCCGG + Exonic
925726422 2:6876753-6876775 CTGAACACTTAAAGTTTGCCAGG + Intronic
929130071 2:38558904-38558926 CAGGCCATTTACTGTTTTCCGGG + Intergenic
933275347 2:80278053-80278075 CTTGACACCTGCCGTTGTCCAGG + Intronic
935028747 2:99302367-99302389 CTGAACACTTACAGTGTGCCAGG - Intronic
939660904 2:144888275-144888297 CTGAATACTTACTGTATTCCTGG - Intergenic
939978163 2:148745161-148745183 TTGGTGACTTACAGTTTTCCTGG + Intronic
940524215 2:154791535-154791557 CTAGACACTGACCCTTATCCAGG + Intronic
941385672 2:164848214-164848236 CTGGACACTTACTCTTTGCCAGG - Intergenic
942383469 2:175418142-175418164 ATGAACTCTTACCGTTTTTCGGG + Intergenic
944666323 2:201962449-201962471 CTGGCCACTTACCCTTCTCTAGG + Intergenic
947767502 2:232647080-232647102 GTGGTCACTTACCTTTTTCCAGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1170508822 20:17056140-17056162 CTGGACACTTACTGCATGCCAGG - Intergenic
1171438878 20:25145670-25145692 ATGGACATCTACGGTTTTCCTGG - Intergenic
1172371077 20:34392658-34392680 CTTGGCACTTACTGTTTGCCAGG - Intronic
1174093005 20:48064552-48064574 TTGCACACTTACTGTGTTCCAGG + Intergenic
1175141180 20:56861193-56861215 CTGGACACTTACTGTGAGCCAGG + Intergenic
1179094726 21:38303127-38303149 TTTGAAACTTACCATTTTCCTGG + Exonic
1179095798 21:38313634-38313656 CTGGACACTTGCCCTTTATCTGG - Intergenic
1182189378 22:28442874-28442896 CAGGACACTTACCTTCTTCCGGG + Intronic
1182780977 22:32867411-32867433 TTGGGCACTTACTGTGTTCCAGG - Intronic
1183059663 22:35328376-35328398 CTGGGCACTTCCCGTGTCCCGGG + Intronic
1184334879 22:43847311-43847333 CTGGTCACTTACCCCATTCCAGG + Intronic
1184666239 22:45990557-45990579 CTGAACACTTAGCGTGTGCCAGG - Intergenic
950189135 3:10964450-10964472 CTGAACACTTACTGTGTGCCAGG - Intergenic
953188076 3:40656632-40656654 CTGAACCCTTACTGTGTTCCAGG - Intergenic
957400141 3:79701002-79701024 CTGGACCCTTACCTTTTACAAGG - Intronic
957846038 3:85736846-85736868 CTGGAAACTTACAGTAGTCCAGG + Intronic
959146789 3:102556563-102556585 CTGGACACTTACTGTCTGTCAGG + Intergenic
960247900 3:115419780-115419802 CTGAGCACTTACAATTTTCCTGG - Intergenic
961033470 3:123626187-123626209 CTGGACACTCACCATGTGCCAGG + Intronic
961824429 3:129591579-129591601 CTGGACACTTACTGTGGGCCAGG - Intronic
968426960 4:530327-530349 CTGGACATTTACTGGTTCCCTGG + Intronic
970145953 4:13035918-13035940 CTGGAAATTTACCCTTTCCCAGG - Intergenic
973239693 4:47944504-47944526 GTGGACCATTACCTTTTTCCAGG - Intronic
979725097 4:123951818-123951840 CTGCCCACTTTCCATTTTCCAGG + Intergenic
983272834 4:165583288-165583310 CTGAACACTTACCATGTGCCAGG + Intergenic
985277911 4:188256326-188256348 CTGAGTACTTACCATTTTCCAGG - Intergenic
985451751 4:190066761-190066783 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985452739 4:190070053-190070075 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985453725 4:190073346-190073368 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985454714 4:190076639-190076661 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985455704 4:190079936-190079958 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985456687 4:190083230-190083252 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985457674 4:190086526-190086548 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985458662 4:190089823-190089845 CCGGACGCTGACCGTTTTCCCGG - Intergenic
985459651 4:190093123-190093145 CCGGACGCTGACCGTTTTCCCGG - Intergenic
991486490 5:67142610-67142632 CTGGACACTTACCGTTTTCCAGG + Intronic
995569456 5:113463986-113464008 CTGGACGCATCCCCTTTTCCTGG - Intronic
995894438 5:116995951-116995973 CTTGTCACTCACCTTTTTCCTGG + Intergenic
999407660 5:151321615-151321637 CTGAGCACTTACTGTATTCCAGG - Intronic
1000640957 5:163700910-163700932 CTGGAGACTTTCTTTTTTCCTGG - Intergenic
1003741962 6:8950872-8950894 TTGGGCACTTACCATTTTCTGGG + Intergenic
1004403003 6:15306085-15306107 CTCGAGGCTTACAGTTTTCCCGG + Intronic
1006523069 6:34583243-34583265 CTGGATACTTACCGTGTACCAGG + Intergenic
1015756726 6:136614633-136614655 GTGGACAATTTCCGTTCTCCTGG - Intronic
1016917178 6:149254800-149254822 CTCGGCACTTACTGTGTTCCAGG + Intronic
1017566432 6:155692301-155692323 CTGAACAGTCACTGTTTTCCAGG + Intergenic
1019096914 6:169589271-169589293 CTGGACACTGACCTTTTGCCAGG + Intronic
1020609364 7:10375958-10375980 CTGGACACTTACACTCTCCCAGG + Intergenic
1025944520 7:66095561-66095583 CTGAACACTTGCCGTGTGCCTGG - Intronic
1027696707 7:81420737-81420759 ATGTACACATACCTTTTTCCAGG - Intergenic
1031557744 7:123198886-123198908 CTGCACACTTACTGTGTGCCAGG + Intronic
1031850379 7:126855874-126855896 CTGGACACCTGCTGTGTTCCAGG - Intronic
1032298728 7:130668175-130668197 CTGGTACCTTATCGTTTTCCTGG - Intronic
1032668866 7:134065487-134065509 GTGGGCACTTACCATGTTCCTGG + Exonic
1032797220 7:135287631-135287653 CTGAGCACTTAGAGTTTTCCAGG - Intergenic
1032860750 7:135876965-135876987 TTTGACACTTACCGATTTCTAGG - Intergenic
1034081543 7:148282521-148282543 CTGGACACTCACTGTGTGCCAGG - Intronic
1034882112 7:154770713-154770735 CTGGACACTTGCTGTTCTACTGG - Intronic
1035666899 8:1385900-1385922 GTGGACAGTTACCCTTCTCCGGG + Intergenic
1035833753 8:2727138-2727160 CTGGACACTCACAGTTTTGGGGG - Intergenic
1036642655 8:10593749-10593771 CTGGACCCTGGCCGTCTTCCAGG + Intergenic
1039085288 8:33773852-33773874 CTGAACACATACTGTGTTCCTGG - Intergenic
1039212894 8:35236104-35236126 CCGGGCCCCTACCGTTTTCCTGG + Intronic
1039740626 8:40379507-40379529 CTGCAGAGTTACAGTTTTCCAGG - Intergenic
1040066058 8:43144939-43144961 CTGAACACTTACTGTGTGCCTGG - Intronic
1040922871 8:52643109-52643131 TTAGACACTTACTTTTTTCCTGG + Intronic
1047772862 8:128044381-128044403 GTAGGCACTTACCATTTTCCAGG - Intergenic
1048205262 8:132410563-132410585 CTGGGCACTTACTGTGTGCCAGG - Intronic
1048241319 8:132744186-132744208 TTGGACACTTACCATTTTCCAGG - Intronic
1048417268 8:134241365-134241387 CTGTAAACTTACAGTTTTCAAGG + Intergenic
1049425390 8:142535784-142535806 CTGGGCACCTACCGTGTGCCCGG - Intronic
1049767822 8:144363141-144363163 CTGCTCACTTACAGTTTCCCGGG + Intergenic
1056978346 9:91282527-91282549 CTGCTCACATACTGTTTTCCAGG - Intronic
1057227669 9:93301071-93301093 CTGGGCACTAACTGTGTTCCAGG - Intronic
1058430379 9:104913427-104913449 CTGTACACTTACTTTGTTCCAGG - Intronic
1058931190 9:109720844-109720866 CTGAGCACTTACTGTGTTCCTGG + Intronic
1059479223 9:114575457-114575479 CTTAACTCTTGCCGTTTTCCAGG + Intergenic
1059553055 9:115249917-115249939 CTGCACATGTACCGTGTTCCAGG + Intronic
1186544739 X:10436792-10436814 CTGGACACTCAACACTTTCCTGG - Intergenic
1192430303 X:71107253-71107275 CTGGAAACTGACTTTTTTCCAGG - Intergenic
1195840010 X:109164983-109165005 CTGGACACATACAATCTTCCAGG - Intergenic
1197079230 X:122392828-122392850 CTGAACTCTTTCAGTTTTCCTGG - Intergenic
1197137018 X:123073216-123073238 CTGGACACTTACTCTTTTCTAGG + Intergenic
1199041938 X:143124441-143124463 TTGAACACTTACTGTGTTCCAGG + Intergenic
1201054676 Y:9976769-9976791 TTGGACACTTGTAGTTTTCCAGG - Intergenic