ID: 991487885

View in Genome Browser
Species Human (GRCh38)
Location 5:67156744-67156766
Sequence AGTGAAGGGGTTGAGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991487876_991487885 24 Left 991487876 5:67156697-67156719 CCTGGGTTAATGTGAGGATACAG 0: 1
1: 0
2: 1
3: 16
4: 154
Right 991487885 5:67156744-67156766 AGTGAAGGGGTTGAGGCCGCAGG 0: 1
1: 0
2: 1
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991487885 Original CRISPR AGTGAAGGGGTTGAGGCCGC AGG Intronic
900352330 1:2241110-2241132 AGTGAAGTGATGGAGCCCGCAGG - Intronic
900391987 1:2437573-2437595 TCTGAAGGGGTGGAGGCTGCAGG - Intronic
901421157 1:9152042-9152064 AGCCCAGGGGTTGAGGCTGCAGG + Intergenic
902397178 1:16138789-16138811 AGGAAAGGGGATGAGGCCGGTGG - Intronic
902987569 1:20164461-20164483 AGGGAAGGGCTTGAGGATGCAGG - Intronic
903647076 1:24902195-24902217 AGTGATGGCGTGGAGGCCGACGG - Exonic
903767488 1:25744051-25744073 AATGAAGGGGTAGGGGCAGCAGG + Intronic
904266258 1:29319987-29320009 AGTGAAGGGTCTGGGGCCCCAGG - Intronic
904355574 1:29936872-29936894 AGTGAAGGGGATGAGCATGCAGG - Intergenic
904930879 1:34086715-34086737 AGTGAAAGGGGTGAGGCTGGAGG - Intronic
905694431 1:39964578-39964600 AGTGAAGGAGTTGAAGGCCCAGG - Intronic
905907307 1:41627612-41627634 AGAGAAGGGGATGGGGCCACAGG - Intronic
906512592 1:46419187-46419209 AGGGCAGGAGATGAGGCCGCAGG - Intergenic
910597242 1:88992941-88992963 AGGGAAGGGGTGGGGGCCACGGG + Exonic
912178024 1:107184495-107184517 AATGAAGGGGGTGAGGTCTCTGG - Intronic
920278967 1:204829053-204829075 AGGGAAAGGGTTGAGGATGCGGG - Intronic
920447898 1:206033839-206033861 AGTACAGGGATTGAGGCAGCAGG + Intergenic
921263911 1:213406676-213406698 AGTGAAGGGGTTGCTGTTGCTGG - Intergenic
921389772 1:214606273-214606295 AGGGAACGGGGTGGGGCCGCTGG - Intronic
921625650 1:217375069-217375091 AGAGAAGGGGGTGAGGCTACAGG + Intergenic
922816313 1:228452326-228452348 AGTGTCAGGGTGGAGGCCGCAGG + Intergenic
923586364 1:235276027-235276049 AGTGAGGGGGCTGAGGCAGAAGG + Intronic
924521527 1:244810312-244810334 AGGAAAGGGGATGAGGCCACAGG + Intergenic
1063197593 10:3758102-3758124 AGAGATGGGGCTGAGGCCACCGG - Intergenic
1063443878 10:6095816-6095838 AGCGAAGGTGTTGGGGCGGCAGG + Intronic
1065936683 10:30526584-30526606 AGCCAAGAGGTTGAGGCTGCAGG - Intergenic
1069958751 10:72067550-72067572 AGGGAAGGGGCTGAGGACACAGG - Intronic
1073294139 10:102428532-102428554 AGTGAAGGGGTGGAGGCAGAAGG - Intronic
1076156112 10:128206982-128207004 AGTGAGGTGGGTGAGGCTGCTGG + Intergenic
1076697012 10:132251803-132251825 AGTGGAGGGTCTGAGGCCCCAGG - Intronic
1076697028 10:132251858-132251880 AGTGGAGGGTCTGAGGCCCCAGG - Intronic
1076697042 10:132251913-132251935 AGTGGAGGGTCTGAGGCCCCAGG - Intronic
1076697058 10:132251968-132251990 AGTGGAGGGTCTGAGGCCCCAGG - Intronic
1078064715 11:8070867-8070889 AGTGAAGGATTTGAAGCAGCAGG + Intronic
1078798087 11:14613755-14613777 AGTAAGGTGGTTGAGGCCTCTGG + Intronic
1080637291 11:34135141-34135163 CGTGAAGGGGAAGAGGCCGAGGG - Intronic
1084319543 11:68365750-68365772 CGGGAATGGGTTGCGGCCGCCGG + Intronic
1084426568 11:69087268-69087290 GGTGGAGGGGTTGAGGCGGCGGG + Intronic
1086915572 11:92526368-92526390 AGTAAAGAAGTTGAGGCCACAGG + Intronic
1089928157 11:122281021-122281043 AGTCAAGGGGGTGGGGGCGCTGG - Intergenic
1090807245 11:130210179-130210201 AGTGAAGGTGGTGGGGCTGCCGG + Exonic
1092263172 12:6963120-6963142 AGGGAAGGGGTTAAGGCAGTGGG + Intergenic
1093650752 12:21642797-21642819 AGTGTGGGGGTGGAGGCTGCAGG - Intronic
1093860239 12:24156327-24156349 AGTAAAGGGGTGGGGGCGGCAGG - Intergenic
1094154152 12:27320142-27320164 AGGGTAGGGGTAGAGGCAGCAGG - Intronic
1096691918 12:53326667-53326689 AGTTAAAGGGTTAAAGCCGCTGG - Exonic
1101523042 12:105502653-105502675 AGTGCAGAGGGTGAGGCCGTGGG + Intergenic
1102976511 12:117210594-117210616 AGTGAAGGGGCTCAGGCATCTGG + Exonic
1103308839 12:119989042-119989064 AGAGCAGGGGTTAAGGCCGCCGG + Intergenic
1105504041 13:20994777-20994799 ACTGAAGAGGTTGAGGCAGGAGG + Intronic
1108611449 13:52088034-52088056 ACTGAGGGGGCTGAGGCCGGAGG - Intronic
1113642672 13:111969444-111969466 AGTGAAGTGGTTGAACCCGATGG + Intergenic
1114351931 14:21862061-21862083 ACGGAAGGGGTTGGGGCTGCAGG - Intergenic
1114411511 14:22504889-22504911 ACTGAAGAGGTTGAGGCAGGAGG + Intergenic
1119382757 14:74239529-74239551 TTTGGAGGGGCTGAGGCCGCAGG - Exonic
1123777005 15:23590186-23590208 AGGGAAGGGGCTGAGTCCACAGG - Intronic
1128078912 15:64844676-64844698 AGTAAAGGGGTTGAGGGGGCAGG + Intronic
1128513414 15:68327288-68327310 ACTGAAGGGGAGGAGGCAGCAGG - Intronic
1128527346 15:68421548-68421570 AGTGAGGGGGCTGTGGCCACAGG + Intronic
1129767551 15:78179762-78179784 TGTGAAGGGCTTCAGGTCGCTGG + Exonic
1130371105 15:83285477-83285499 CGCGGAGGGGCTGAGGCCGCAGG + Intergenic
1130631910 15:85578172-85578194 ACTGAAGAGGCTGAGGCGGCAGG + Intronic
1132583550 16:695957-695979 GGAGAAGGGGTGGAGCCCGCAGG + Intronic
1132614198 16:832218-832240 AGGGAAGGAGCTGAGGCCACAGG - Intergenic
1132748612 16:1447215-1447237 AGTCAAGGGGCTGAGGGGGCTGG - Intronic
1136519605 16:30787069-30787091 ACTGAAGGGGTTAAGTCCCCTGG - Exonic
1137578272 16:49618113-49618135 GGTGCAGGGGTTAAGGGCGCAGG + Intronic
1138799021 16:60003101-60003123 AGTGATGGGGTTGATTCTGCAGG - Intergenic
1139705132 16:68736193-68736215 AGTAAAGGGGCTGAGGCAGGAGG + Intergenic
1139955468 16:70691067-70691089 AGCCAAGGGGTTGAGGCCTCTGG - Intronic
1140130038 16:72152445-72152467 AGTGAAGGTGTTGTGGCTTCCGG + Intronic
1141319749 16:82996295-82996317 AGTCATGGGGTAGAGGCCACTGG - Intronic
1142029326 16:87830724-87830746 AGTGAAATGGCTGGGGCCGCTGG - Exonic
1142289145 16:89184810-89184832 AGTGCAGGGGCTAAGGGCGCTGG - Intronic
1142875856 17:2852004-2852026 AGGGAAGGTGATGAGGGCGCTGG - Intronic
1144812680 17:18010746-18010768 AGGGCAGGGGCTGAGGCTGCGGG + Intronic
1146009045 17:29179812-29179834 AGTGAAAGAGTGAAGGCCGCTGG + Intronic
1146226985 17:31075447-31075469 AGTGAAGGCGTGGAGGAGGCAGG - Intergenic
1147314605 17:39613657-39613679 AGGGAAGGGGCTGAGGACTCTGG - Intergenic
1148274234 17:46289289-46289311 TTTGAAGGGGTTGAGGCAGGAGG - Intronic
1149680637 17:58504711-58504733 AGGGAAGGTGTTGAGCCCTCTGG - Intronic
1151259918 17:72908248-72908270 TGTGAATGGGTTGAGGCTGGGGG + Intronic
1151344793 17:73494918-73494940 AGCCAAGAGGTTGAGGCCACTGG - Intronic
1152157302 17:78643239-78643261 AGCCAAGAGGTTGAGGCTGCAGG + Intergenic
1152759511 17:82100663-82100685 AGTGCAGGGGTGGAGGCAGCCGG - Intergenic
1152884253 17:82840053-82840075 AGTGTAGGAGTTGAGCCCTCGGG + Exonic
1153615481 18:6929689-6929711 AGAGAAGGCGTAGAGGCCTCAGG - Intergenic
1154983655 18:21527035-21527057 AGTGGAGTGGTGGAGGCAGCAGG - Intergenic
1155106260 18:22669232-22669254 AGTGTAGGGGATGAGGCAGGGGG + Intergenic
1160256542 18:77252024-77252046 GGTGAAGTGGTTGAGGCGGCGGG + Intronic
1166218481 19:41351527-41351549 AGGGAGGGGGATGAGGCCGCCGG + Intronic
1166986574 19:46663562-46663584 AGTGAAGGGGATGGGGCCCTGGG + Intergenic
1167112715 19:47471596-47471618 ACTGAAGGTGTTGGGGCGGCTGG + Intronic
1167425146 19:49426370-49426392 AAGGAAGGGGTTAAGGCCGAAGG - Intronic
1167818551 19:51905640-51905662 AGTGCAGGGGTTGAGGTGTCAGG - Intronic
925152409 2:1624237-1624259 AGGGAAGGGGTTGACCCTGCCGG + Intergenic
926758520 2:16254962-16254984 AGGGATGGGGTTGAGGACACAGG + Intergenic
928951493 2:36817309-36817331 GGTGAAGGGGCTGAGGCTTCTGG + Intergenic
931321002 2:61175040-61175062 AGTGAAAGGGTGGAAGCAGCTGG + Intergenic
931711061 2:64989323-64989345 AGTGAGCGGGCTGGGGCCGCTGG + Intronic
932056012 2:68445084-68445106 TGTGAAGGAGGTGAGGCTGCTGG + Intergenic
932801275 2:74744585-74744607 AGAGAAGTGTGTGAGGCCGCAGG + Intergenic
935368352 2:102318516-102318538 AGTGAAGGCATTGAGTCAGCAGG + Intronic
937206238 2:120238825-120238847 ACTGAAGGAGTTGAGGGCGGAGG + Intergenic
937222676 2:120350848-120350870 AGGCAAGGGGATGAGACCGCAGG + Exonic
942046505 2:172102236-172102258 AGGGACGTTGTTGAGGCCGCTGG + Exonic
945128240 2:206537275-206537297 AGTGAAGGGTTTTTGGCAGCAGG + Intronic
946310215 2:218879094-218879116 AATTAAGGGCTTGAGGCTGCTGG - Intergenic
946848330 2:223880949-223880971 AGTGATGGGATTGGGGCAGCTGG - Intronic
948379181 2:237541149-237541171 AGGGAAGGGGTGGAGGGCTCAGG - Intronic
948463958 2:238143329-238143351 GGTGAAGGGGTGCAGGCAGCTGG + Intronic
948695946 2:239733083-239733105 AGTGGAGGGGTTAAGGGCCCTGG + Intergenic
948695955 2:239733113-239733135 AGTGGAGGGGTTCAGGGCCCTGG + Intergenic
948695990 2:239733233-239733255 AGTGGAGGGGTTCAGGACCCTGG + Intergenic
948695998 2:239733263-239733285 AGTGGAGGGGTTCAGGACCCTGG + Intergenic
948696049 2:239733443-239733465 AGTGGAGGGGTTCAGGACCCTGG + Intergenic
948696057 2:239733473-239733495 AGTGGAGGGGTTCAGGACCCTGG + Intergenic
948696065 2:239733503-239733525 AGTGGAGGGGTTCAGGACCCTGG + Intergenic
948696073 2:239733533-239733555 AGTGGAGGGGTTCAGGACCCTGG + Intergenic
948696112 2:239733683-239733705 AGTGGAGGGGTTCAGGACCCTGG + Intergenic
948710182 2:239820502-239820524 GGAGAAGGGGCTGAGGCCACAGG - Intergenic
1171364836 20:24616660-24616682 GGTGCAGGGGGTGAGGCAGCTGG + Intronic
1171439320 20:25148069-25148091 AATGAAGGGGGTGAGGCCTGAGG - Intergenic
1171988672 20:31678735-31678757 GGTGAAGAGGTCGAGGCCACAGG - Intronic
1172325305 20:34029827-34029849 AGTGAAGGGATTGAGGGTGCGGG - Intronic
1174857237 20:54057978-54058000 AATGAAAGGGTCGAAGCCGCAGG - Intronic
1175889792 20:62311037-62311059 AGTGAAGAGGAGGAGGCCTCGGG + Exonic
1176273472 20:64248540-64248562 AGGGAAGGGGCTGAGGACGTAGG + Intergenic
1178974494 21:37209427-37209449 TGGGAAGGGGTTGAGGGGGCTGG - Intergenic
1179548149 21:42125787-42125809 AGTGGAGGGGCTGAGGGTGCAGG + Intronic
1180583297 22:16861601-16861623 ACTCAAGAGGTTGAGGCTGCAGG + Intergenic
1181442504 22:22943949-22943971 AGGGAAGGGGTAGAGGGAGCTGG + Intergenic
1181630678 22:24149667-24149689 AGTGATGGGGTGGAGTCCACGGG - Intronic
1182139275 22:27938830-27938852 ACTGAAGAGGTTGAGGCAGGAGG + Intergenic
1182355590 22:29721055-29721077 AGGGAAGGGGCTACGGCCGCAGG - Intronic
1183196327 22:36356089-36356111 AGTGTCTGGGCTGAGGCCGCTGG - Intronic
1183583762 22:38740380-38740402 TGTGAAGGAGCTGAGGCGGCTGG - Exonic
1184871102 22:47239003-47239025 AGAGAAGGGGTGGGGGCAGCTGG - Intergenic
1184995542 22:48204858-48204880 GGTGAAGGGCTTGAGGCAGTTGG - Intergenic
1185393798 22:50576821-50576843 AGTGGAGGGGTTCAGGCACCTGG - Intronic
950268347 3:11592479-11592501 AGTAAAGGGGTGGAGGCCCCGGG - Intronic
953947764 3:47163983-47164005 AGGGGAGGGGAGGAGGCCGCAGG + Intergenic
954028357 3:47800987-47801009 AGTGAAAGGGTTGAATCAGCTGG - Intergenic
954325130 3:49859355-49859377 AGTAAAGGGGAAGAGGCTGCTGG - Exonic
954397155 3:50298910-50298932 ACTGAAGGGGTTAAGGCCGCGGG - Intronic
955402615 3:58603990-58604012 AGGAAAGAGGTTGAGGCCGTGGG + Intronic
961450667 3:127000962-127000984 TGTGAAGGGGTGGAGGTGGCAGG + Intronic
962295761 3:134184654-134184676 ACTGAGGGGGTTGAGGCTGGAGG + Intronic
965189930 3:165514987-165515009 AGTTTAGAGGTTGAGGCAGCAGG - Intergenic
967835071 3:193955777-193955799 ACTGAAGTGGTTGAGGTTGCTGG + Intergenic
968441738 4:627828-627850 GGTGAAGGGGTGGTGGCAGCGGG - Intronic
968828187 4:2914951-2914973 GGTGAAGGGGTTGGGGCCCGTGG - Exonic
970595677 4:17597830-17597852 ACTGAAGGGGATGTGGCAGCAGG + Intronic
971156845 4:24092234-24092256 AGAAAAGGGGTTGAGGCCTACGG - Intergenic
971320423 4:25601028-25601050 GGGGCAGGGGGTGAGGCCGCAGG + Intergenic
974602175 4:64097651-64097673 AGTGTAGTGGTTGAGGGCTCTGG + Intergenic
975720174 4:77241706-77241728 AGTGAAGGAGTTGGGGAGGCAGG + Intronic
977414980 4:96721667-96721689 AATGAAGGTGTAGAGGCGGCTGG + Intergenic
981097865 4:140799886-140799908 AGTGATGGTGATGAGGCCGGGGG - Intergenic
982132587 4:152243990-152244012 AGTCATGGGGTTGAGGTCACTGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
986000896 5:3629770-3629792 AGTAAAGGGGTTAAGACCGAAGG - Intergenic
990319810 5:54618665-54618687 AGAGAAGGGGTTGAGGTTACTGG + Intergenic
990914554 5:60889981-60890003 AGGGAAGGGGCTGAGGCTGGAGG + Intronic
991487885 5:67156744-67156766 AGTGAAGGGGTTGAGGCCGCAGG + Intronic
991665224 5:68993112-68993134 AGTGAGGGGGTTCAGGACACAGG + Intergenic
992810017 5:80377274-80377296 ACTGGAGAGGTTGAGGCAGCAGG + Intergenic
993001905 5:82388957-82388979 AGTGAAGGGCTTGAGGACGTGGG + Intergenic
996423173 5:123284837-123284859 AGTGCAGGGGATGAGGACGATGG + Intergenic
996695773 5:126393161-126393183 AGTGAAGGGGATGAAGCTGATGG - Intronic
997971408 5:138405427-138405449 AGCTGAGAGGTTGAGGCCGCAGG + Intronic
998896908 5:146809727-146809749 ATTGGAGGGTTTGAGGCAGCAGG + Intronic
1000874577 5:166620123-166620145 AGTGAAGGGGTTGAGTAGGGAGG + Intergenic
1001266546 5:170278399-170278421 AGTGCAGGGGTTGGGGGCGGGGG + Intronic
1005589847 6:27312062-27312084 GGTGAAGGGGCTGAGGTGGCCGG + Exonic
1006582069 6:35082963-35082985 GGCGAAGGGGTGGAGGCCTCTGG + Intronic
1006725448 6:36196659-36196681 AGGGAAGGGGTGGAGGTGGCGGG + Intergenic
1011610570 6:89146512-89146534 AGCGATGAGGTTGTGGCCGCAGG - Exonic
1012246957 6:96936983-96937005 AGTGAAGGGGTTGGGGTGGTGGG - Intronic
1013315779 6:108941377-108941399 AGTGAAGTGGTTAAGGCCATAGG - Intronic
1015695423 6:135975019-135975041 AGTGATGGTGCTGAGGCCCCTGG + Intronic
1019512332 7:1423964-1423986 AGTGAGGGGGAAGAGGCGGCAGG + Intergenic
1023965473 7:44961449-44961471 ACTGAGGGGGTTGAGGGGGCTGG + Intergenic
1024789261 7:52945148-52945170 AGTGAAGGATTTAAGGCCCCAGG - Intergenic
1025520795 7:61726811-61726833 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1025545152 7:62156372-62156394 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1026970116 7:74462691-74462713 AGTGATGGGGTGCAGGCCACAGG - Intronic
1027366352 7:77462412-77462434 AGAGAATGGGCTGAGGCGGCTGG + Intergenic
1032081789 7:128862811-128862833 AGGGTGGGGGTTGAGGCCGACGG + Intronic
1034656701 7:152735538-152735560 AATGGAGGGCTTGAGGCAGCTGG - Intergenic
1034990117 7:155542765-155542787 AGTGAAAGGGCTGTGGCCGCAGG - Intergenic
1035389855 7:158497002-158497024 AGGGAAGGGGGAGAGGGCGCAGG - Intronic
1035977006 8:4323968-4323990 AGTGAAGTCCTTGAGGCAGCAGG - Intronic
1036654001 8:10663801-10663823 AGTGGGGGTGTTGAGGCCTCAGG - Intronic
1037618557 8:20543168-20543190 GGTGAAGGGGTTGTGGGCGGCGG + Intergenic
1038816602 8:30911695-30911717 AGTGGAGAGGCTGAGGTCGCTGG - Intergenic
1040588303 8:48765045-48765067 AGGGAAGGTGTGGAGGCCACAGG - Intergenic
1042713926 8:71751034-71751056 AGTGCAGAGGTTGAGGGCACTGG - Intergenic
1048339443 8:133527366-133527388 AGTAAAGGGGTTGAGGTGGTGGG + Intronic
1049284601 8:141767680-141767702 GGAGAAGGGGCTGAGGCTGCTGG + Intergenic
1049284614 8:141767741-141767763 GGCGAAGGGGCTGAGGCCGCTGG + Intergenic
1049398213 8:142411797-142411819 AGTGATGGGGTACAGGCCCCGGG - Intergenic
1050557880 9:6805739-6805761 TGTGAAGGAGTTCAGGCAGCTGG + Exonic
1056718478 9:89053509-89053531 AGAGAAGGAGCTGAGGCCCCAGG - Intronic
1057301289 9:93885813-93885835 AATGCAGGGGTTAAGGCCACTGG + Intergenic
1058189255 9:101892743-101892765 AGGAAAGGGGTTGGGGCAGCAGG + Intergenic
1060481364 9:124018388-124018410 AGTGAGGGGGTTCGGGGCGCCGG + Intronic
1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG + Exonic
1190479305 X:50860021-50860043 AGTGGTGGGGTTGAGGGAGCGGG - Intergenic