ID: 991488596

View in Genome Browser
Species Human (GRCh38)
Location 5:67163365-67163387
Sequence GAGTGTCCCAGAAGAGGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991488596 Original CRISPR GAGTGTCCCAGAAGAGGGGA TGG (reversed) Exonic
900118600 1:1039185-1039207 GAGAGTAGCAGAAGAGGGGTGGG + Intronic
900173427 1:1281502-1281524 GGATGGCCCAGAAGAGGGGGAGG + Exonic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901305138 1:8227341-8227363 GAAAGTCCTAGAAGATGGGAAGG + Intergenic
901959106 1:12810446-12810468 GAGTGGCCCAGAGGAGCTGATGG - Intergenic
902240977 1:15089167-15089189 GAGTCCCCCAGAAGAGGGGAAGG - Intronic
902393406 1:16119150-16119172 GAGGGTGCCAGGAGTGGGGAGGG + Intergenic
902449069 1:16485200-16485222 GAGTGTCCCACTAGTGGGGATGG + Intergenic
903545044 1:24118706-24118728 CTGTGTCCCAGGAAAGGGGAGGG + Intergenic
903938151 1:26910883-26910905 GAGAATCCCAGGAGAGGGGCTGG + Intronic
904044206 1:27600499-27600521 GGGTGGGACAGAAGAGGGGAAGG + Intronic
904245992 1:29188550-29188572 GATGGTCCCAGAAGAGGACAGGG + Intergenic
904474771 1:30757753-30757775 CAGTGTCTCAGAGGAGGGGACGG - Exonic
905409086 1:37755965-37755987 CTGTGTGGCAGAAGAGGGGAGGG + Intronic
905653166 1:39669745-39669767 GAGTGATGCAGAAGAAGGGATGG - Intronic
906459933 1:46029382-46029404 GAGGGTCCCAGAACAGTGAAAGG - Intronic
906541409 1:46589335-46589357 GAGTGTCCCAGACCAAGGAAGGG + Intronic
907236010 1:53048320-53048342 GAGTGTTCCAGGAGGAGGGAGGG + Intronic
907763808 1:57388549-57388571 GAGAGGCCCAGGAGAGGGGATGG - Intronic
908331663 1:63076892-63076914 CAGTGTTCCAGAAGAGAAGAGGG + Intergenic
908477644 1:64505551-64505573 GTGTGCCCCAGAGGAGGGGGCGG - Intronic
908960033 1:69685763-69685785 CAGAGTCCCAGGAGAGGAGAAGG + Intronic
909638932 1:77850222-77850244 GAGTGACCCAAGAGAGGGCAAGG + Intronic
909693477 1:78436971-78436993 TAGGGTCCAAGATGAGGGGAAGG + Intronic
910624466 1:89291839-89291861 CAGTGTCCCAGAAGGGGTCAGGG - Intergenic
911354032 1:96794144-96794166 GATTGTCACAGAAAAGGGGAAGG - Intronic
911499618 1:98668915-98668937 AACTGTCCCAGAGGAGAGGAGGG + Intronic
913093987 1:115498823-115498845 GAGTGACCCAGAGGAAGGAAAGG - Intergenic
916416762 1:164599572-164599594 GACTGTCCCTCAGGAGGGGAGGG + Intronic
917617266 1:176758860-176758882 GAGTTTCACAGATGAGGTGATGG - Intronic
918138730 1:181701944-181701966 GCATGTGCCAGCAGAGGGGAAGG + Intronic
918143889 1:181739285-181739307 GAGTCTCCAGGAAGAGGGGAAGG - Intronic
919857264 1:201714376-201714398 GAGTGTCCAAGATGCGGGCATGG - Intronic
919939628 1:202277430-202277452 GTGACTCCCAGAAGAAGGGAGGG - Intronic
920033817 1:203052774-203052796 CAAAGGCCCAGAAGAGGGGAGGG - Intronic
921010036 1:211132975-211132997 GAGAGTCCTAGGAGCGGGGATGG - Intronic
922146803 1:222954685-222954707 AAGTGTCATAGGAGAGGGGAGGG + Intronic
922188291 1:223295485-223295507 GAGTGTGCCATAATAGAGGATGG + Intronic
922950837 1:229558009-229558031 GAGTGGCCCAGGAGAGGCGGCGG + Intronic
923410528 1:233704318-233704340 CAGTGTTCCAGAAAAGGAGATGG + Intergenic
924865474 1:247974876-247974898 GAGTGTCCAAGAAGATGAGAAGG - Intronic
1063518441 10:6719580-6719602 GAGTTTTCCAGGAGAGGGGTGGG + Intergenic
1063818713 10:9809030-9809052 GAGTGGCCCAGAAGAGATGGAGG - Intergenic
1064950767 10:20847604-20847626 GAGGATCAAAGAAGAGGGGAGGG + Intronic
1066119404 10:32269880-32269902 GAGTGGCCCAGAAGAAAGCAGGG - Intronic
1067288361 10:44923837-44923859 TAGAGGCCCAGAAGAGTGGAGGG - Intronic
1067341693 10:45411022-45411044 GAGTTTTCCAGGAGAGGGGTGGG + Intronic
1067685693 10:48465045-48465067 GAGAGACCCTGATGAGGGGAGGG - Intronic
1068302631 10:55163831-55163853 GAGTGTTCCAGGAAAGGGGCGGG - Intronic
1070341797 10:75504745-75504767 GAGTGTGGCATAAGAGGGGTAGG + Intronic
1070828254 10:79403670-79403692 CAGGAACCCAGAAGAGGGGAGGG - Intronic
1071177533 10:82943622-82943644 CAGGATCCCAGAAGATGGGATGG + Intronic
1071950832 10:90701133-90701155 GTGGGGCCCAGAAGAGGAGAAGG - Intergenic
1072219578 10:93316241-93316263 GAGTGTGCCAGGAGAGGGAAGGG + Intronic
1072718936 10:97769167-97769189 GATTGTCCCAGAAAATGGGAAGG + Intronic
1073536646 10:104282614-104282636 GAGTGTCCAAGAGGAGGGACTGG + Intronic
1073583522 10:104688143-104688165 GAGTCTCCCAGAAGCGGGTCTGG + Intronic
1076123251 10:127953148-127953170 GAGTGTGTCAGAACAGGAGAAGG + Intronic
1077502867 11:2917115-2917137 GAGTGTCCAGGGAGAGGCGAGGG + Intronic
1078105973 11:8358197-8358219 TGGTGTCCCAGGAGAGGGCAGGG - Intergenic
1078541719 11:12218362-12218384 GAGGGTCCCAGATGAGTGGGGGG - Intronic
1078631066 11:13005006-13005028 GAGTATCTCAGAAGAGGAAATGG - Intergenic
1078770688 11:14348748-14348770 GAGGATTCCAGAATAGGGGAAGG - Intronic
1079110477 11:17602421-17602443 GAGGGTGCTAGAGGAGGGGAGGG + Intronic
1081614063 11:44579976-44579998 GAGTGACAAGGAAGAGGGGATGG + Intronic
1081667850 11:44926962-44926984 CAGTGTCCCAGAAATGGGGATGG + Intronic
1081805316 11:45886839-45886861 TGGTGCCCCAGGAGAGGGGAAGG - Intronic
1082667683 11:55994082-55994104 GACTGTCACAGAAGAAGTGATGG + Exonic
1083012962 11:59421569-59421591 GAGAATCTCAGAAGAGGGAAAGG + Intergenic
1083201073 11:61121438-61121460 GAGGGTGCCAGAAGGAGGGAAGG + Intronic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1084357591 11:68650320-68650342 GAGTGGCCCAGAAGCAGGGGTGG + Intergenic
1085081496 11:73638341-73638363 CAGTGTTCCAGAGGAGGGAATGG + Intergenic
1085886335 11:80526725-80526747 TGGAGACCCAGAAGAGGGGAGGG + Intergenic
1086278582 11:85160229-85160251 GTGTGTTCCAGAACAGGAGAAGG + Intronic
1087013003 11:93530843-93530865 GAGTCCCGCAGCAGAGGGGAAGG - Intronic
1088773715 11:113061532-113061554 GACAGTCACAGAAGAGGGAAAGG + Intronic
1088900828 11:114115785-114115807 GTCTTTCCCAGAGGAGGGGAGGG + Intronic
1088908602 11:114173336-114173358 GAGGGGCCCAGGGGAGGGGAAGG + Intronic
1091241272 11:134053906-134053928 CTGTGGCCCAGAGGAGGGGAGGG + Intergenic
1091325401 11:134683153-134683175 GTCTGTCCCATAAGAGAGGAAGG - Intergenic
1093802283 12:23388867-23388889 GAGTTTCCCGGATGAGGCGATGG - Intergenic
1096584205 12:52608961-52608983 GGGGGTGACAGAAGAGGGGAGGG + Intronic
1096870572 12:54589723-54589745 GGGAGTCCTGGAAGAGGGGAAGG + Intergenic
1100784133 12:98061224-98061246 TAGTGGGCCAGAAGAGGAGATGG + Intergenic
1101254747 12:102965957-102965979 GAGTGAGAAAGAAGAGGGGAAGG - Intergenic
1101989953 12:109476743-109476765 GAGTTTCCAGGAAGTGGGGAAGG - Intronic
1104536615 12:129623431-129623453 TAGAGACTCAGAAGAGGGGAGGG - Intronic
1104870784 12:131994041-131994063 GCGTTTCCAAGAGGAGGGGATGG + Intronic
1105023525 12:132833870-132833892 CAGTGTCCCAGGAGAGGGAAAGG + Intronic
1105675735 13:22670028-22670050 CAGCGTCCCAGAGGAGGGTAGGG - Intergenic
1105795531 13:23848658-23848680 GAGGCTCCTAGAAGAGGGGGAGG + Intronic
1106079196 13:26486674-26486696 GTGTGTCCCAGACGAGAGGATGG + Intergenic
1106189599 13:27439588-27439610 GAGTGGCCCGGCAGAGGGCAGGG + Intronic
1106227231 13:27794493-27794515 GAGGCTCCCTGAGGAGGGGAAGG - Exonic
1107668337 13:42716188-42716210 GAGTGACAGAGAGGAGGGGAGGG + Intergenic
1107959058 13:45542945-45542967 GAGTATCTGAGAAGAGAGGAGGG - Intronic
1108737407 13:53298597-53298619 GAGTTTTCCAGAAAAGGGGTGGG - Intergenic
1110774655 13:79394140-79394162 CAATGTGCCAGCAGAGGGGAAGG - Intronic
1110843747 13:80171025-80171047 GATTGTGCCAGAGGAGGGGCTGG - Intergenic
1113775776 13:112943980-112944002 GAGGGTCCCGGGTGAGGGGAGGG + Intronic
1116493799 14:45536771-45536793 GAGTGTCCAGGGAGAGGGGTAGG - Intergenic
1116897719 14:50333502-50333524 GAGTTTTCCAGGAGAGGGCAGGG - Exonic
1116962317 14:50979010-50979032 GAGTGCCTGAGAAGAGGTGAGGG - Intronic
1117545077 14:56786854-56786876 GGGTGTCCCAGATGTGTGGAAGG - Intergenic
1120759673 14:88274197-88274219 GTGTGTGGAAGAAGAGGGGAGGG - Intronic
1120929858 14:89837327-89837349 GAGTGTGGGAGAAGAGAGGATGG + Intronic
1121243592 14:92447285-92447307 GAGGGGTCCAGAAGTGGGGAAGG - Intronic
1121262319 14:92575537-92575559 GAGTGTTCCAGGAAAGGGGTGGG + Intronic
1121631514 14:95424398-95424420 GAGTGACCCAGGAGAGGGACAGG + Intronic
1122213066 14:100185477-100185499 GAGTTTTCCAGGAGAGGGGCAGG + Intergenic
1123994554 15:25709589-25709611 GGGTGCCCCAGACGAGGAGACGG + Intronic
1124438889 15:29673001-29673023 GAGTTTTCCAGGAAAGGGGAAGG + Intergenic
1125756969 15:42070941-42070963 GAGTGACCCAGAGGAGAGAAGGG - Intronic
1126097770 15:45101343-45101365 GACTTTCCCAGAAGGGAGGAGGG - Intronic
1127260636 15:57324111-57324133 CAGGGTCCCAGTTGAGGGGAAGG - Intergenic
1127549304 15:60021586-60021608 GAGTTTTCCAGAAAAGGGGCAGG + Intronic
1127932737 15:63607821-63607843 GTGTGTGCAGGAAGAGGGGAAGG - Intergenic
1130849718 15:87781097-87781119 GGGTGTTCCAGAAGAGAGCAGGG - Intergenic
1130936928 15:88478662-88478684 GAGTGCCCTAAAAGCGGGGAGGG + Exonic
1131047563 15:89325819-89325841 AAGCATCCCAGAGGAGGGGATGG - Intronic
1132251355 15:100337735-100337757 GAGTGAACGAGAGGAGGGGAGGG - Intronic
1132279889 15:100603164-100603186 TAGTGTCTCAGAGGTGGGGAGGG - Intronic
1132392619 15:101450169-101450191 GAGGGTCCAAGCAGAGGGGTGGG - Intronic
1132531232 16:450874-450896 GTGTGCCCCAGGCGAGGGGAAGG - Intronic
1132691535 16:1183818-1183840 GAGTCTCCCAGCAGGTGGGACGG - Intronic
1132868484 16:2105084-2105106 GAGGGGCCCAGATGTGGGGAGGG - Intronic
1132894906 16:2224095-2224117 AAGGGGCCCAGAGGAGGGGAGGG - Intronic
1134523105 16:14927578-14927600 GAGGGGCCCAGATGTGGGGAGGG + Intronic
1134549525 16:15132480-15132502 GAGGGGCCCAGATGTGGGGAGGG - Intronic
1134710772 16:16326229-16326251 GAGGGGCCCAGATGTGGGGAGGG + Intergenic
1134718943 16:16370517-16370539 GAGGGGCCCAGATGTGGGGAGGG + Intergenic
1134948829 16:18342416-18342438 GAGGGGCCCAGATGTGGGGAGGG - Intergenic
1134955813 16:18381642-18381664 GAGGGGCCCAGATGTGGGGAGGG - Intergenic
1135532172 16:23264161-23264183 GAGAGCCCAGGAAGAGGGGAGGG + Intergenic
1136398289 16:30004806-30004828 GAGTGCCGCAGAAGAGGGAGAGG + Intronic
1136867301 16:33768340-33768362 GAGTTTCCCAAAAGAAGGGAAGG - Intergenic
1137023809 16:35454454-35454476 GAGTGAGCCAGAAGAGGGGAAGG + Intergenic
1137695396 16:50458441-50458463 GAGTTTCCCAGGAAAGGGGCGGG - Intergenic
1138083751 16:54115565-54115587 GAGCTTCCCAGGAAAGGGGACGG + Exonic
1138318929 16:56094401-56094423 GTGGGGCCCAGAACAGGGGAAGG - Intergenic
1138693965 16:58793929-58793951 GAGGGTTCCAAAAGATGGGAGGG - Intergenic
1139253119 16:65515723-65515745 AAGTGTCTTAGAATAGGGGAAGG + Intergenic
1139399658 16:66671276-66671298 GAGTCTCCAAATAGAGGGGAAGG + Intronic
1140257662 16:73350699-73350721 GAATGTTCCAGAAGATGAGATGG + Intergenic
1141048635 16:80740020-80740042 GTGGGTGCCAGAGGAGGGGACGG + Intronic
1141436512 16:84002661-84002683 GAATGTCACCGAAGAGGGCAGGG - Exonic
1142129362 16:88425750-88425772 GTGGATCCCAGAAGAGGGAAAGG + Intergenic
1142312825 16:89323785-89323807 GTGTGGCCCTGAGGAGGGGAAGG - Intronic
1203104861 16_KI270728v1_random:1347863-1347885 GAGTTTCCCAAAAGAAGGGAAGG + Intergenic
1203128653 16_KI270728v1_random:1614505-1614527 GAGTTTCCCAAAAGAAGGGAAGG - Intergenic
1142688666 17:1591992-1592014 GATCGGCCCAGCAGAGGGGACGG + Intronic
1143004746 17:3822706-3822728 GAGTGTCCAAGAACTGTGGAAGG - Intronic
1143447162 17:7016431-7016453 GAGACTAACAGAAGAGGGGACGG - Intronic
1143448875 17:7023953-7023975 GAGCGTCCCAGAATTGGGGGCGG + Intronic
1143624810 17:8103682-8103704 GAAAGTCCCAGAAGTGGGGCAGG + Intronic
1144889123 17:18483876-18483898 GATAGTCCCAGAAAAGGGGACGG - Exonic
1145143086 17:20460420-20460442 GATAGTCCCAGAAAAGGGGACGG + Exonic
1145724590 17:27106812-27106834 GAGTGTTCCAGGAAAGGGGTGGG + Intergenic
1146659150 17:34653047-34653069 GAGAGTCCTGGAAGTGGGGAGGG - Intergenic
1147018790 17:37514023-37514045 GAGTGTCCCAGGAGTGGGACAGG - Intergenic
1147327759 17:39677926-39677948 CAGTGTCTCAGAAGTGGGGGAGG + Intronic
1147925913 17:43945779-43945801 GAGTTTTCCAGAAAAGGGGTGGG - Intergenic
1148486936 17:47996599-47996621 TGGTTTGCCAGAAGAGGGGAAGG - Intergenic
1148740442 17:49889812-49889834 AGGTGACCCAGAAGAGGGGCTGG - Intergenic
1149016388 17:51913490-51913512 GAGTTTCCCAGAAGATGGCATGG - Intronic
1149421918 17:56519938-56519960 GAGTGTCCCAGAAAGGGTCAAGG + Intergenic
1150280723 17:63928479-63928501 GGGTGTCCCTGCTGAGGGGAAGG + Intergenic
1151496214 17:74459777-74459799 GACTGTTCCAGGAGAGGGGAGGG - Intergenic
1151540978 17:74764380-74764402 GAGGCTCCTAGAAGAGGGGATGG + Intronic
1151653604 17:75485313-75485335 GAGGATCCCAGAGGAGGGGAAGG + Intronic
1152084129 17:78207079-78207101 GAGTGTCCCAGCAGTGAGAATGG - Exonic
1152341873 17:79730054-79730076 GAGTTTCCCAAAAGAAGGGAAGG - Intergenic
1153022864 18:647142-647164 GACTGTTCCAAAAGGGGGGATGG + Intronic
1155234326 18:23804361-23804383 GTGAGTCCCAGAACAAGGGAAGG - Intronic
1157253386 18:46116095-46116117 GACTGTCTCAGAAAAAGGGAAGG + Intronic
1158571348 18:58599161-58599183 AAGTGTCTCAGAAGAGTGAATGG - Intronic
1158588426 18:58760261-58760283 GGGTGTCCCAGCAGAAGGGGTGG - Intergenic
1158918517 18:62162748-62162770 TAGTAGCACAGAAGAGGGGAGGG - Intronic
1159903962 18:74074164-74074186 AGGTTTCTCAGAAGAGGGGAGGG - Intronic
1161145161 19:2673330-2673352 AAGTGTCCCAGCAGAGTGTAAGG + Intronic
1161390674 19:4018857-4018879 GAAGGTTCCAGAAGAGGGAATGG + Intronic
1161581063 19:5081398-5081420 GAGTGTCCCCAGAGTGGGGAGGG + Intronic
1162824742 19:13244586-13244608 GAGTCTTCCAGAAAAGGAGAAGG + Intronic
1163197578 19:15733889-15733911 CAGTGGCCCAGGAGAGGGGATGG + Intergenic
1163332668 19:16651065-16651087 AAGTGTCCAAGAACAGGGGAAGG - Intronic
1163564405 19:18041669-18041691 GTCTGTCCCAGCAGTGGGGAGGG + Intergenic
1164518648 19:28959306-28959328 GAGTTTTCCAGAAAAGGGGTGGG - Intergenic
1165406803 19:35636053-35636075 GACGGTCCCAGGAGAGGGGGTGG - Intronic
1166441139 19:42816259-42816281 AAGTGTCCCAGGAAAGGGCAGGG + Intronic
1166460618 19:42984866-42984888 AAGTGTCCCAGGAAAGGGCAGGG + Intronic
1166703817 19:44897232-44897254 GGGTGGCCCAGGAGATGGGAAGG + Intronic
1166778099 19:45324399-45324421 GAGGGTCACAGATGAGGGGACGG + Intergenic
1168088992 19:54069643-54069665 GAGTTTTCCAGGAAAGGGGAGGG + Intergenic
1168255323 19:55161618-55161640 GAGGGGCCCAGGAGAGGGGCTGG - Intronic
925263445 2:2547677-2547699 GAGGGTGCCAGGAGAGGGGCAGG - Intergenic
926124343 2:10262738-10262760 GTGTGTCCAAGGAGAGGAGATGG + Intergenic
928121698 2:28588371-28588393 TCGTCTCTCAGAAGAGGGGAAGG - Intronic
930149387 2:48043219-48043241 GAGTGTTCCAAAAAAGGGAAGGG + Intergenic
931835652 2:66096063-66096085 GAGCTTCCCAGACCAGGGGAAGG - Intergenic
932200066 2:69818349-69818371 GAGGGTCCCAGATAAGGGAAAGG + Intronic
932304852 2:70694799-70694821 GAGTGTTCCAGTAGAGGTGAAGG - Intronic
933291445 2:80442692-80442714 TTGTCTTCCAGAAGAGGGGAAGG - Intronic
933407666 2:81881671-81881693 GAGTTTCCCAGGAAAGGGGAGGG - Intergenic
933940298 2:87239592-87239614 GAGTGTGTCAGCAGAGTGGAGGG + Intergenic
934947147 2:98550224-98550246 GACTGTCCCTGAAGCAGGGAGGG + Intronic
935708922 2:105880510-105880532 GAGTGTCCCAGGAGTGGAGGAGG + Intronic
936041116 2:109150228-109150250 GAGTGTTCCAGCGGAGGGAATGG + Intronic
936352840 2:111726184-111726206 GAGTGTGTCAGCAGAGTGGAGGG - Intergenic
936468360 2:112775201-112775223 GAGTTTCCCAGAAGAAGAGGAGG + Exonic
937400541 2:121579297-121579319 AAGTGAGCTAGAAGAGGGGAAGG - Intronic
937537302 2:122906052-122906074 GAGTTTTCCAGAAAAGGGGTGGG + Intergenic
937712124 2:124990149-124990171 GAGTTTTCCAGGAGAGGGGCTGG - Intergenic
937845497 2:126574405-126574427 GAGGATCCCACAAGAGTGGAAGG - Intergenic
938313005 2:130306572-130306594 GAGAGTCCCAAAGGAGGTGAAGG + Intergenic
938575492 2:132599346-132599368 GTGTTTTCCAGAAGAGGGGTGGG + Intronic
939575111 2:143886506-143886528 GTGTGCCCCAGAAGAGGAAATGG + Intergenic
940240783 2:151560944-151560966 TACTGTCCCAGAAGGGGGAAAGG + Intronic
944279279 2:197876278-197876300 TATTGGCCCAGAAGAGGGGCTGG + Intronic
945195632 2:207234879-207234901 GAGGGTCCCAGAAGAAAGCAGGG + Intergenic
946049504 2:216850179-216850201 GTGTCTCCCCGGAGAGGGGAGGG - Intergenic
948606804 2:239141070-239141092 CCGTTTCCCAGAAGAGGAGATGG + Intronic
948902243 2:240962694-240962716 GTGTGTCCCAGAGGAGGAGGCGG - Intronic
1168794811 20:604466-604488 GAGTGTCCCGGAACAGGCCATGG + Exonic
1169136848 20:3202991-3203013 CAGTGTCCAAGCAGAGGGCAAGG - Intronic
1171200062 20:23233515-23233537 GAGTGTGCGAGGAGAGGTGAGGG + Intergenic
1171278888 20:23880208-23880230 AAGTTCCCCAGAAGAGGGCATGG - Intergenic
1172775345 20:37403741-37403763 GGGTGGCACAGAAGTGGGGAAGG - Exonic
1175635298 20:60577901-60577923 GAGTTTTCCAGAAAAGGGGTGGG + Intergenic
1176268628 20:64223823-64223845 GAGCGTGACAGGAGAGGGGAGGG - Intronic
1177004269 21:15652027-15652049 GAGTGTCAAAGAAAAAGGGATGG - Intergenic
1178415858 21:32404623-32404645 GAGTGGGCCAGAGGTGGGGAGGG + Intergenic
1178690639 21:34746891-34746913 GAGAGGCACAGAACAGGGGAAGG + Intergenic
1178909639 21:36664233-36664255 GAGATTTCCAGATGAGGGGAGGG - Intergenic
1180030447 21:45203081-45203103 GAGTGTCTCAGGGGAGGGGCTGG - Intronic
1180653735 22:17401159-17401181 GAGTGTTCCAGAGGTGAGGAGGG + Intronic
1181166889 22:20988763-20988785 GAGTGTGAGGGAAGAGGGGAGGG - Intronic
1181201854 22:21222059-21222081 GAGTGCCTCAGAAGAGGAGAGGG - Intronic
1181513987 22:23401254-23401276 GGGTGGCCCAGAAGGAGGGACGG + Intergenic
1181684403 22:24518581-24518603 GAAGGTGCCAGAAAAGGGGATGG - Intronic
1182285797 22:29246125-29246147 GAGTGTCCAGGCAGAGGCGAGGG + Intronic
1182518469 22:30871985-30872007 GAGTTTCCCAGCAGTCGGGAAGG - Intronic
1182787496 22:32919938-32919960 GCTTGTCCCAGAGGAGGGGATGG - Intronic
1183648255 22:39139090-39139112 GAATGTCCCAGGAGAGCTGATGG + Intronic
1184147010 22:42617690-42617712 GAGTGGGGAAGAAGAGGGGACGG - Intergenic
1184866732 22:47205561-47205583 GAGGGTCCCTGATCAGGGGAAGG - Intergenic
1185318902 22:50191180-50191202 GGCTGTCCAAGAAGAGGGCAGGG + Intronic
1203225058 22_KI270731v1_random:73369-73391 GAGTGCCTCGGAAGAGGAGAGGG + Intergenic
1203265770 22_KI270734v1_random:13415-13437 GAGTGCCTCGGAAGAGGAGAGGG - Intergenic
949573432 3:5315287-5315309 GAGCCTCCCAGAAGAGGAGTTGG - Intergenic
949903496 3:8839051-8839073 GAGTGGGCCAGGAGATGGGAAGG + Intronic
950649324 3:14397443-14397465 GAGAGTCCCAGGAGTGGAGATGG + Intergenic
952729692 3:36625886-36625908 GAGTGTCCCTGATGAGGTGCTGG - Intergenic
953161450 3:40424102-40424124 GAGTTTCCCAGAAGAGGTCATGG + Intronic
953640815 3:44705892-44705914 GTGTGTTCCAGAAAAGGAGAAGG + Intergenic
954686027 3:52370726-52370748 GCTTTTCCCAGAAGAGGGGCTGG + Exonic
954848253 3:53578349-53578371 GAGTGGCCCAGCAGAGGTGAGGG + Intronic
956811465 3:72867702-72867724 GTGTGTTCTAGAAGTGGGGATGG - Intergenic
958792692 3:98670299-98670321 GAGAGTCCCAGGAAAAGGGAGGG - Intergenic
960224696 3:115156148-115156170 GAGTTTCCCAGGAAAGGGGCAGG + Intergenic
961004887 3:123398257-123398279 GTGGGTCCCAGTAGAGGGGCAGG - Intronic
961115028 3:124322045-124322067 GAGCATCTCAGATGAGGGGAAGG + Intronic
962095282 3:132286502-132286524 GAGTTTTCCAGAAAAGGGGTGGG - Intergenic
962196449 3:133367772-133367794 AAGTGTCCAGGAAGAGGGGATGG - Intronic
963505420 3:146179000-146179022 GAGGGTACCAGTTGAGGGGATGG - Intergenic
964515716 3:157505499-157505521 AAGTTTCCCAAAGGAGGGGAAGG - Intronic
965075185 3:163966424-163966446 GAGACTCCAAAAAGAGGGGAAGG + Intergenic
965398214 3:168186427-168186449 GTGGTTGCCAGAAGAGGGGATGG + Intergenic
967694357 3:192514598-192514620 GAGGGCCCCGGAAGAAGGGAAGG + Intronic
969608844 4:8216063-8216085 GAGGGCTCCAGAAGAGGGGCAGG - Intronic
970603934 4:17661809-17661831 GTGAGTCCCAGGAGAGGGGAGGG + Intronic
970876642 4:20878341-20878363 GAGTGTCCTAGAAGGAGGAAAGG - Intronic
971299593 4:25430854-25430876 GACTGGCCCAGAGGAGGGAAGGG - Intergenic
971478598 4:27094654-27094676 GTGTGGCCAAGAAGAGGGGCTGG + Intergenic
974746948 4:66089130-66089152 GTGTGGTCCAGAAGAGGAGAAGG - Intergenic
975682643 4:76891919-76891941 GAATATCCCAGGAGAGGGAAGGG - Intergenic
977130681 4:93233086-93233108 GAGTATTCCAGGAAAGGGGAAGG + Intronic
978005411 4:103609749-103609771 GAGAGTGGCAGGAGAGGGGATGG - Intronic
980082942 4:128363532-128363554 GAGTGTGCAAGAAGAGAAGAAGG + Intergenic
980656395 4:135792859-135792881 AAGTGTCATAGAAGAGGGGGAGG - Intergenic
984539612 4:181021478-181021500 GAGTGTTCCAGAAAAGGGGTGGG + Intergenic
985820511 5:2156933-2156955 GAGTTTTCCAGAAAAGGGGTGGG - Intergenic
988778174 5:34496011-34496033 GGGTGCCCGAGAAGTGGGGAAGG - Intergenic
990018749 5:51099700-51099722 GAGTTTTCCAGGAAAGGGGAGGG - Intergenic
991488596 5:67163365-67163387 GAGTGTCCCAGAAGAGGGGATGG - Exonic
997422304 5:133779195-133779217 GAGTCACCCAGCAGAGAGGATGG - Intergenic
997641710 5:135452727-135452749 GAGGGTCTCAGGAGAGGGCAGGG + Intergenic
999811168 5:155128716-155128738 GAATGGCACAGCAGAGGGGAAGG - Intergenic
1000955710 5:167541003-167541025 AAGTGGCCCAGAAGTGGGAACGG + Intronic
1001405993 5:171478032-171478054 GAGTGACCCTGAAGTGGGGCTGG - Intergenic
1003901995 6:10662993-10663015 GAGTTTTCCAGAAAAGGGGTAGG - Intergenic
1005394865 6:25370919-25370941 TGGTGACTCAGAAGAGGGGAGGG - Intronic
1005399381 6:25415897-25415919 GAGCGCACCAGAAGAGGGAAAGG + Intronic
1006302322 6:33200217-33200239 GAGTGCCCCAGCAGAAGGGCAGG - Intronic
1006481896 6:34301857-34301879 TATTGACCCAGAAGTGGGGAGGG - Intronic
1006998471 6:38285245-38285267 GTGGGACACAGAAGAGGGGAAGG + Intronic
1007654787 6:43445545-43445567 GAGTCTGGCAGAAGAGGGGTTGG - Intronic
1007832921 6:44652659-44652681 GTGTGTCTCAGAATTGGGGAAGG + Intergenic
1009433781 6:63595151-63595173 GAGGACTCCAGAAGAGGGGAGGG + Intergenic
1010250081 6:73697964-73697986 GTGTGCCCCAGAAGAGGAAATGG + Intronic
1011440763 6:87384608-87384630 GAGTTTCCCTGCAGAGGGAAAGG + Intronic
1014167971 6:118247127-118247149 GAGTGTATAAGAAGATGGGATGG - Intronic
1015507894 6:134008118-134008140 TTTTATCCCAGAAGAGGGGATGG + Intronic
1016070160 6:139729081-139729103 GCGTGTCCTAGAAAAGGGAAGGG - Intergenic
1016767533 6:147811629-147811651 GAGTGCCAGAGAAGAGGGGGAGG + Intergenic
1017044367 6:150333689-150333711 GAGTGTCCCTGAAGAGTGCTGGG - Intergenic
1017791631 6:157804920-157804942 GGGTGCCCCAGAAGCAGGGAGGG + Intronic
1017887528 6:158611296-158611318 GAGTGTCCCAGTTGTGGAGAAGG - Intronic
1018786291 6:167110511-167110533 TAGAGCCCCAGAAGAGGGGAAGG - Intergenic
1019850413 7:3550473-3550495 CAGTGGCCCAGAAGAGCTGAAGG - Intronic
1020098505 7:5381381-5381403 GTGTGGCCCAGAGGTGGGGAAGG - Intronic
1020188352 7:5975443-5975465 TTGTGTCCCTGGAGAGGGGAAGG - Intronic
1020247659 7:6442345-6442367 GAGTGTCTAGGAAGAGGGAACGG + Intronic
1020294563 7:6749325-6749347 TTGTGTCCCTGGAGAGGGGAAGG + Intergenic
1023849067 7:44140398-44140420 GAGTGTCCCAGAGGAGGAGCTGG - Exonic
1024637285 7:51301171-51301193 GGGAGCCCCAGAGGAGGGGAGGG - Intronic
1026875428 7:73876682-73876704 GGATGTCCCATTAGAGGGGATGG + Intergenic
1029058361 7:97770838-97770860 GAGTTACCCAGACAAGGGGAGGG + Intergenic
1029499071 7:100916526-100916548 GAGTTTTCCAGAAGAGGGGTAGG - Intergenic
1029514926 7:101018351-101018373 GGGAGTCCCAGGAGAAGGGAGGG - Intronic
1033547854 7:142418227-142418249 GAGGGTCCCAGAAGAGGGCAGGG + Intergenic
1033601828 7:142894080-142894102 GAGAGACCCAGAAGCAGGGAAGG + Intergenic
1034250005 7:149681987-149682009 GAGTTTTCCAAAAGAGGGGTGGG + Intergenic
1034748984 7:153550889-153550911 GAATGTGACAGAAGAGAGGACGG - Intergenic
1034773376 7:153801572-153801594 CAGTGTCCCAGCAGAGCGGCTGG - Intergenic
1035253648 7:157613003-157613025 GAGAGTCCCTGAGGAGGGGCCGG + Intronic
1035380474 7:158437057-158437079 TGGAGTCCCAGAAGAGGAGAAGG - Intronic
1037173169 8:15917916-15917938 CAGTGTCACTGAAGAGGGAAGGG + Intergenic
1037634275 8:20686908-20686930 GAATGTCCCAGAAGAGACAAGGG - Intergenic
1038434337 8:27524435-27524457 GGGCGTCTCAGAAGAAGGGAGGG - Intronic
1038454508 8:27663858-27663880 GTGGGGCCCAGAACAGGGGAAGG - Intronic
1038730671 8:30124182-30124204 GAAAATGCCAGAAGAGGGGATGG + Intronic
1039576150 8:38625595-38625617 GAGTGTCAGAGAAGTGGGGCTGG + Intergenic
1039861113 8:41458543-41458565 GAGTTTCCCAGGAAAGGGGAGGG - Intergenic
1040672797 8:49712862-49712884 GATTTCCCCAGAAAAGGGGAGGG + Intergenic
1040806788 8:51404855-51404877 GGGTGCCCCAGAGCAGGGGACGG + Intronic
1042350779 8:67775205-67775227 GAGTGTCACAGAAGAGGAAGAGG - Intergenic
1044235639 8:89826944-89826966 GATTGTCCCATCAAAGGGGAAGG - Intergenic
1046526353 8:115386477-115386499 GAGTTTTCCAGGAAAGGGGATGG + Intergenic
1046961858 8:120121557-120121579 GGGTGTCCCAGAAGCAGGAATGG + Intronic
1048409801 8:134161091-134161113 GAGTGTTCCAGAAGAGGTGTTGG + Intergenic
1049215064 8:141404020-141404042 GAGTGTGCCCCGAGAGGGGATGG - Intronic
1049390636 8:142368525-142368547 GAGAGTCCCAGGAGAGAAGATGG + Intronic
1049505827 8:142997173-142997195 GTGTGTCCTAGAAAAGAGGAGGG - Intergenic
1049848942 8:144820527-144820549 GTGTGTCCCTCAAGAGGGGCCGG - Intergenic
1052816819 9:33107965-33107987 GTGTGCCCCAGAAGAGGAAAAGG + Intronic
1053020161 9:34689067-34689089 GAGTGTGCCAGACCAAGGGAAGG + Intergenic
1053108263 9:35432807-35432829 GAGGTGCACAGAAGAGGGGATGG - Intergenic
1053148403 9:35727571-35727593 AAGTGCCCCAGGAGTGGGGAGGG - Intronic
1053303856 9:36970269-36970291 GAGTGACCAGGGAGAGGGGATGG + Intronic
1053609471 9:39697474-39697496 GAGTGTACCAGGAGAGCAGAAGG - Intergenic
1053867367 9:42454059-42454081 GAGTGTACCAGGAGAGCAGAAGG - Intergenic
1054088844 9:60774018-60774040 GAGTGTACCAGGAGAGCAGAAGG + Intergenic
1054244053 9:62644923-62644945 GAGTGTACCAGGAGAGCAGAAGG + Intergenic
1054558178 9:66679471-66679493 GAGTGTACCAGGAGAGCAGAAGG + Intergenic
1055672422 9:78620801-78620823 GAGTGTACCAGCAGAGAGAATGG + Intergenic
1055943147 9:81669328-81669350 GAGTGGCCCAGAAGGAGGGAGGG - Intronic
1056775129 9:89506547-89506569 GATTGTCCCAGAAGTGGGGGAGG - Intergenic
1056889453 9:90477532-90477554 GAGTGGCTCAGAACAGGGGGTGG - Intergenic
1057016589 9:91657684-91657706 GGCAGTCCCAGCAGAGGGGATGG - Intronic
1057076794 9:92142155-92142177 GGGGGTCCCAGAAGCTGGGAGGG + Intergenic
1057633024 9:96736245-96736267 GACTGTCAAAGAGGAGGGGAGGG - Intergenic
1057874370 9:98742820-98742842 GACTGTCGCAGAAGAGGGAATGG + Intronic
1060521800 9:124298238-124298260 GAGGGTCCCTGCTGAGGGGAAGG - Intronic
1060894822 9:127210916-127210938 GGCTGTCCCAGAGGAGGTGAGGG + Intronic
1061300365 9:129701104-129701126 AAATATCCCACAAGAGGGGAAGG + Intronic
1061634037 9:131894724-131894746 TAGTGTCCCTAAAGAAGGGAAGG - Intronic
1062298341 9:135847824-135847846 AAGTATCCCAGAACAGGGAAGGG + Intronic
1062379481 9:136280394-136280416 GAGTCTCCCAGGGGAGGGGCCGG + Intergenic
1203782334 EBV:107595-107617 GAATGTACCAGAAGATGGGCAGG - Intergenic
1186187983 X:7040433-7040455 AAGTGTCCCAGGAAAGGGCAGGG + Intergenic
1186699102 X:12070176-12070198 GAGTGGCCAAGAGGAGGGGTGGG + Intergenic
1187091330 X:16099765-16099787 GGCTGTCCCAAACGAGGGGAAGG + Intergenic
1187850719 X:23589131-23589153 CAGAGACTCAGAAGAGGGGAGGG + Intergenic
1189107889 X:38256090-38256112 GAGCGCCCCGGAAGCGGGGACGG - Intronic
1189713118 X:43835815-43835837 GAGCTACCCAGAAAAGGGGAAGG - Intronic
1190584022 X:51919411-51919433 TAGTGTCCCAGAAAAGGGTATGG + Intergenic
1191613421 X:63141263-63141285 GAGTTTTCCAGAAAAGGGGTGGG - Intergenic
1191622876 X:63237664-63237686 GAGTTTTCCAGAAAAGGGGTGGG + Intergenic
1194521050 X:94919212-94919234 GTGAGGCCCGGAAGAGGGGAAGG + Intergenic
1196733894 X:118967978-118968000 GAGTGTCTCTGAAGAGGGCAGGG + Intergenic
1197027376 X:121770059-121770081 TAGAGTCTCAGAAGAGAGGAAGG - Intergenic
1197701414 X:129602944-129602966 GAGTGTTCCTGAAGAAGGGGTGG - Intergenic
1197708950 X:129652890-129652912 GAGTGTTCCAGAGGAAGGTAGGG - Intronic
1197903498 X:131398434-131398456 GAATGTCACAGAAGAAGGCAGGG + Intronic
1198362023 X:135904880-135904902 CAGTGTCCATGAGGAGGGGATGG + Intronic
1199601476 X:149543843-149543865 GGGGGTCCCAGAAGGAGGGAAGG + Intronic
1199648901 X:149935641-149935663 GGGGGTCCCAGAAGAAGGGAAGG - Intronic