ID: 991488702

View in Genome Browser
Species Human (GRCh38)
Location 5:67163955-67163977
Sequence TATGCAGGAGGCGCCACCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991488699_991488702 21 Left 991488699 5:67163911-67163933 CCGAAGGCTGTGGAAAGGTCAAG 0: 1
1: 0
2: 1
3: 14
4: 192
Right 991488702 5:67163955-67163977 TATGCAGGAGGCGCCACCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991488702 Original CRISPR TATGCAGGAGGCGCCACCGC TGG Exonic
900193922 1:1364375-1364397 CCTGCAGGTGGAGCCACCGCAGG - Intergenic
903703296 1:25266982-25267004 CTTGCAGAAGGCGCCACCGCAGG - Intronic
903712562 1:25337311-25337333 CTTGCAGAAGGCGCCACCGCAGG - Intronic
904850704 1:33457160-33457182 TAGGCATGAGGCACCACCCCTGG + Intergenic
906258261 1:44367179-44367201 TAAGCAGGAGGCCCCTCCACTGG - Intergenic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1069626174 10:69868997-69869019 TGTGCAGGAGGCCCCAAGGCAGG - Intronic
1078855873 11:15206238-15206260 TAAGCAGGAGGCCCCACCTCTGG + Intronic
1092140873 12:6182583-6182605 TATGCAGGAGGACCCACATCTGG - Intergenic
1092243747 12:6851448-6851470 TATCAAGGAGGCGTCACCCCTGG - Exonic
1101618201 12:106358319-106358341 TTTGCATGAGGCACCACAGCCGG + Intronic
1102349281 12:112180149-112180171 TATGCTGGAGTTGCCACAGCTGG - Intronic
1104849432 12:131864268-131864290 GATGGAGGAGGAGCCACCCCTGG - Intergenic
1105446405 13:20461537-20461559 TAGGCAGGAGGCTCCAGAGCTGG + Intronic
1105507727 13:21024553-21024575 TATGCAGGAAGAGCTCCCGCAGG - Intronic
1122643765 14:103177735-103177757 GATACAGGAGGCTCCACCCCAGG + Intergenic
1133168059 16:3962950-3962972 TGTGCAGGGGGAGCCCCCGCGGG + Exonic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1137665396 16:50246356-50246378 CGGGCAGGAGCCGCCACCGCCGG - Intronic
1138416451 16:56874314-56874336 GGTGCAGGAGGCGCCAGAGCTGG + Intronic
1140807307 16:78544897-78544919 TAGGCAGGAGCCACCACCCCTGG - Intronic
1142187570 16:88701714-88701736 TAGGCAGGAGGCCCCAGCTCGGG + Intronic
1142256347 16:89015537-89015559 TATGCAGGTGGCTTCACCCCTGG + Intergenic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1148207991 17:45791563-45791585 TTTCCAGGAGATGCCACCGCTGG - Intronic
1151402670 17:73866049-73866071 TTTGAAGGAGGCTCCATCGCCGG + Intergenic
1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG + Intronic
1163271147 19:16254685-16254707 TGTGCAGGAGGGGCCCCAGCAGG + Intergenic
1166298798 19:41902798-41902820 GCTGCAGGCGGCGGCACCGCGGG - Exonic
1168096483 19:54118380-54118402 TGTGCAGGAGGAGACACAGCTGG + Exonic
1168219150 19:54947956-54947978 TAGGCAGGAGGCACCACAGTTGG - Intronic
1168563391 19:57402765-57402787 GATGCAGGAGGCTCAACTGCTGG - Intronic
935727714 2:106038143-106038165 GATGCAGGATGCTCCACTGCTGG + Intergenic
942088428 2:172464209-172464231 CATGCAGCAGGTGCCACCGGAGG - Intronic
947488656 2:230575256-230575278 GATGCAGGAGCCAACACCGCAGG + Intergenic
1180094636 21:45550238-45550260 CAGGCAGGAGGCGCCTCCCCAGG - Intergenic
1180221734 21:46363587-46363609 TATGAAGGAGGAGCTACAGCGGG + Exonic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
955139423 3:56254477-56254499 TAAGGAGGAGGCCCCACCTCTGG + Intronic
955240051 3:57170103-57170125 TGTGCAGGAGGCGCCAAGGCTGG - Intronic
956442322 3:69292566-69292588 TAGGCAGGAGGCACCAGGGCTGG - Intronic
962240461 3:133747109-133747131 TATGAAGGGGGCCCCACCTCAGG - Intronic
973867030 4:55124882-55124904 CAGGCAGGAGGTGCCTCCGCAGG - Intronic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
987195686 5:15523673-15523695 TGTGCAGAAGGCGCCACGGACGG - Intronic
991488702 5:67163955-67163977 TATGCAGGAGGCGCCACCGCTGG + Exonic
993900273 5:93580052-93580074 TCTGCAGCCGGCTCCACCGCGGG + Intergenic
1001751103 5:174132091-174132113 TATGCAGTAGGAGCCACGACAGG - Intronic
1011443103 6:87408267-87408289 CCTGCCGGAGGCGCCACCCCAGG + Intronic
1022539853 7:31125451-31125473 TATGCAGGATGCGTCAACCCTGG - Intergenic
1038583496 8:28770066-28770088 TGAGCAGCAGGGGCCACCGCAGG + Intronic
1038624289 8:29175736-29175758 CATGGAGGAGGAGCCTCCGCTGG - Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG + Intergenic
1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG + Intergenic
1053346025 9:37378784-37378806 CGTGCAGGATGCGCCACCGAGGG + Intergenic
1057690144 9:97276628-97276650 TATGCAGGAAGCGGCCCAGCAGG - Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1062264213 9:135679430-135679452 TAGACAGGAGGCCCCAGCGCTGG - Intergenic
1195319430 X:103709712-103709734 AATGCAGGATGCCCCACCCCTGG - Intronic
1197309300 X:124884158-124884180 AATGCAAGAGGCTCCACTGCTGG + Intronic