ID: 991500066

View in Genome Browser
Species Human (GRCh38)
Location 5:67268083-67268105
Sequence AGCAGGAGGCTGTAGGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 367}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991500058_991500066 19 Left 991500058 5:67268041-67268063 CCTGGCTCCCTTCTGGGAGGGAG 0: 1
1: 0
2: 3
3: 40
4: 342
Right 991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG 0: 1
1: 0
2: 4
3: 35
4: 367
991500062_991500066 -6 Left 991500062 5:67268066-67268088 CCACGTCTCAATTTGACAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG 0: 1
1: 0
2: 4
3: 35
4: 367
991500052_991500066 30 Left 991500052 5:67268030-67268052 CCCTGGCTTGACCTGGCTCCCTT 0: 1
1: 0
2: 0
3: 27
4: 279
Right 991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG 0: 1
1: 0
2: 4
3: 35
4: 367
991500060_991500066 12 Left 991500060 5:67268048-67268070 CCCTTCTGGGAGGGAGGACCACG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG 0: 1
1: 0
2: 4
3: 35
4: 367
991500061_991500066 11 Left 991500061 5:67268049-67268071 CCTTCTGGGAGGGAGGACCACGT 0: 1
1: 0
2: 0
3: 11
4: 110
Right 991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG 0: 1
1: 0
2: 4
3: 35
4: 367
991500053_991500066 29 Left 991500053 5:67268031-67268053 CCTGGCTTGACCTGGCTCCCTTC 0: 1
1: 0
2: 5
3: 30
4: 251
Right 991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG 0: 1
1: 0
2: 4
3: 35
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991500066 Original CRISPR AGCAGGAGGCTGTAGGTCAG TGG Intergenic
900211301 1:1457115-1457137 AGCAGGAGGCTGTGGACGAGAGG - Exonic
900851050 1:5143351-5143373 AGCAGGAGGAGGGAGGTCAGGGG + Intergenic
901812784 1:11777258-11777280 AGAAGAAGGCTGTAGGTGAGGGG + Intronic
902721111 1:18304605-18304627 CCCAGCAGGCTGCAGGTCAGGGG - Intronic
903180466 1:21602587-21602609 ATCAAGAAGCGGTAGGTCAGAGG - Intronic
903577717 1:24349243-24349265 ATGAGGAGACTGTGGGTCAGAGG - Intronic
904132757 1:28287521-28287543 AGCAGGAAGTTGTAGGACTGTGG - Intergenic
904307172 1:29597645-29597667 AGCACGTGGCTGTGGGTTAGAGG - Intergenic
904405740 1:30286899-30286921 ACCTGCAGGCTGTAGGTAAGTGG - Intergenic
904539915 1:31225835-31225857 GGCTGGAGGCTGTAGGGAAGAGG + Intronic
906142160 1:43540272-43540294 AGCAAGAGGCTGTAGACCAGAGG - Intronic
906150214 1:43583265-43583287 AGCAGGAACATGCAGGTCAGGGG - Intronic
906757745 1:48335483-48335505 ATCAGATGGCTGTAGGTGAGTGG - Intronic
906951848 1:50341147-50341169 TGCAGGTGGCTGTGGGACAGAGG - Intergenic
915465629 1:156096268-156096290 AGCAGGATCCTGTAGGTGGGTGG + Intronic
916102345 1:161403240-161403262 AGCAGGAGGCAATAGGGCAAAGG + Intergenic
916301288 1:163277206-163277228 AGCAGGAGGTTCCAGGTCATAGG - Intronic
917537895 1:175887747-175887769 TGCGGGAGGATGTGGGTCAGAGG + Intergenic
917923190 1:179767662-179767684 AGCAGCAGGCTGCAGGTAGGGGG - Intronic
918974891 1:191471141-191471163 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
919928780 1:202208013-202208035 AGCAGGGCTCTGCAGGTCAGTGG - Intronic
919993949 1:202730401-202730423 CTCAGGAGCCTGTAGGTCACAGG - Intronic
920232718 1:204481176-204481198 AGCAGGAGGGTGTGTGTCGGGGG - Intronic
922014833 1:221634718-221634740 AGGAGAAGGGTGAAGGTCAGTGG + Intergenic
922195068 1:223352726-223352748 AGCAGGCAGCTGGAGGTGAGAGG + Intronic
922974376 1:229771372-229771394 AGGAGAAGGCTGGAGGGCAGGGG + Intergenic
923384339 1:233451738-233451760 AGCGGGAGGCTGAAGGTCAGGGG + Intergenic
923904943 1:238373615-238373637 AATAGGAAGCTGTTGGTCAGAGG + Intergenic
924920185 1:248620809-248620831 AGCAGGAGTTTCTAAGTCAGAGG - Intergenic
1063702652 10:8400466-8400488 AGCCGGTGGCTGGAGGTAAGAGG + Intergenic
1064291379 10:14037033-14037055 ACTGGGTGGCTGTAGGTCAGAGG - Intronic
1066678659 10:37914898-37914920 AGATGGAGGCTGTAGTGCAGTGG + Intergenic
1067249989 10:44578057-44578079 AGGAGCAGGGTGAAGGTCAGTGG + Intergenic
1067471625 10:46542163-46542185 GGCAGAAGGCTGCAGGGCAGGGG + Intergenic
1067696852 10:48541983-48542005 AGGAGAAGGCTGTAGGGCAGGGG + Intronic
1067852446 10:49762272-49762294 GTCCGGAGGCTGCAGGTCAGGGG + Exonic
1069045747 10:63741499-63741521 ATCAGGAGGCTGCAGGTGGGAGG - Intergenic
1070366261 10:75740269-75740291 AGCTGGAGGCTGAGGGGCAGCGG + Intronic
1070718855 10:78742616-78742638 AGCAAGAGTCTGTTGGGCAGAGG + Intergenic
1071475339 10:86020580-86020602 TGGAGGTGACTGTAGGTCAGAGG + Intronic
1071920024 10:90339221-90339243 AGCAGGAGGCAGTAATGCAGTGG + Intergenic
1073367331 10:102954165-102954187 ATCAGGAGGCTGGAGTGCAGTGG + Intronic
1073513587 10:104057957-104057979 AGTGGCAGGCTGTGGGTCAGAGG - Intronic
1073815965 10:107207082-107207104 AGCTGGAGACTGGAGCTCAGAGG - Intergenic
1074185848 10:111098886-111098908 AGCAGGAGGCTCTGGGTCCTTGG - Intergenic
1075100869 10:119505204-119505226 AGCAGGAGGCCGCAGGTGAGTGG + Intronic
1075259370 10:120949465-120949487 CAGAGGAGGCTGTAGTTCAGAGG + Intergenic
1075689441 10:124385711-124385733 TGCAGGAGGCTGAGGGGCAGTGG + Intergenic
1076984251 11:223818-223840 GGGAGGAGGCTGGAGGGCAGGGG - Intronic
1076984272 11:223890-223912 GGGAGGAGGCTGGAGGGCAGGGG - Intronic
1076984314 11:224034-224056 GGGAGGAGGCTGGAGGGCAGGGG - Intronic
1077141556 11:1027042-1027064 GGCAGGAGGCTGCAGGAAAGAGG + Exonic
1077180149 11:1208608-1208630 AGCAGGAGCCTGTAGGGCTTGGG + Intergenic
1077338633 11:2016428-2016450 AGGAAGAGGCTGCAGGGCAGGGG - Intergenic
1077342370 11:2031835-2031857 AGGAGGAGGCTTTAGGCGAGAGG + Intergenic
1077539821 11:3141276-3141298 AGCAGGAGGCGCTTGGTCAAAGG - Intronic
1083669822 11:64293325-64293347 AGTGGGAGGCTGTGGGACAGAGG + Intronic
1083678785 11:64341980-64342002 AGCCAGCCGCTGTAGGTCAGGGG - Exonic
1083959650 11:66007484-66007506 CAGAGGAGGCTGTAGCTCAGGGG - Intergenic
1084120499 11:67066298-67066320 GTCAGGAGGCTGGAGGGCAGAGG - Intronic
1084381820 11:68817657-68817679 GGCAGGAGGCTGGGGGTCAAGGG + Intronic
1084641487 11:70429185-70429207 AGGAGGAAGCTGGAGGTGAGTGG + Exonic
1085519259 11:77128571-77128593 AGCAAGTGGCTGTGGGGCAGAGG - Intronic
1088920943 11:114259437-114259459 AGCAGGAGGCAACAGGGCAGTGG + Intronic
1088962193 11:114679867-114679889 AGCAGGAGAATGTGGATCAGGGG + Intronic
1089141622 11:116289297-116289319 AGCAGGAGAATGGAAGTCAGTGG - Intergenic
1089313204 11:117573626-117573648 GACAGGAGGCTGCAGGGCAGAGG - Intronic
1089678311 11:120105376-120105398 AGCGGGAGGCTGTGGGGCAGGGG + Intergenic
1090794478 11:130123051-130123073 AGCAGGAGGCTGCATGTTAATGG - Intronic
1202821617 11_KI270721v1_random:71610-71632 AGGAAGAGGCTGCAGGGCAGGGG - Intergenic
1202825356 11_KI270721v1_random:87024-87046 AGGAGGAGGCTTTAGGCGAGAGG + Intergenic
1091691837 12:2602321-2602343 AGAAGGAGGGTCCAGGTCAGGGG - Intronic
1092451547 12:8607004-8607026 ATCAAGAGGCTGTGGGTGAGAGG + Exonic
1094453159 12:30603515-30603537 AGCAGATGGCTGTAGGTGTGTGG - Intergenic
1095450273 12:42323868-42323890 GGCACGAGGCTGTAGTGCAGTGG - Intronic
1095967485 12:47878808-47878830 AGCAGGAGGGTCTTGGTGAGTGG - Intronic
1096648876 12:53052403-53052425 AGCAGGGGCCTGTGGGACAGTGG - Intronic
1097687997 12:62709103-62709125 AGCAAGAGGGTGTAGAGCAGTGG - Intronic
1098275544 12:68808285-68808307 AGCAGCAGGATCTCGGTCAGAGG - Exonic
1099469984 12:83036170-83036192 AGCAGGAGGCTAAAAGTAAGAGG - Intronic
1099517905 12:83621757-83621779 AGAAGGAGGCTAAAGGTAAGAGG + Intergenic
1100471030 12:94893260-94893282 AACACGAGGCAGTAGGTGAGAGG - Intergenic
1100635498 12:96431323-96431345 AGAAGAAGGCAGGAGGTCAGAGG + Intergenic
1100894184 12:99160835-99160857 ATCAGGTGGCTGTAGGTGTGCGG + Intronic
1102141227 12:110616771-110616793 AGCAGGAGGCTGACTGTGAGTGG + Intronic
1102176286 12:110877608-110877630 AGCAGGGAGATGGAGGTCAGAGG - Intronic
1102584907 12:113915945-113915967 AGCTGGGGGCTGTGGGTGAGGGG - Intronic
1102741450 12:115211105-115211127 AGAAGGAGGCTGCAGGACAGGGG + Intergenic
1102896813 12:116604778-116604800 AGTGGGAGTTTGTAGGTCAGGGG + Intergenic
1102999867 12:117377041-117377063 AGCTTGGAGCTGTAGGTCAGAGG + Intronic
1103142422 12:118560307-118560329 AGCAAGAGGCAGGAGGTCACTGG + Intergenic
1103246415 12:119461747-119461769 AGCAGGAGGCCCCAGGTGAGTGG + Intronic
1103858783 12:123994916-123994938 AGAAGGAGGATCTAGATCAGTGG + Intronic
1104372163 12:128232947-128232969 AGGAGGAGGGACTAGGTCAGAGG + Intergenic
1105307601 13:19180151-19180173 ACCAGGAGGCTGGAGGAGAGTGG + Intronic
1106524485 13:30527891-30527913 AGCAGGAGGGTATAGATTAGGGG - Intronic
1106825845 13:33519505-33519527 AGGAGGAGGGTGGAGGCCAGTGG - Intergenic
1108481198 13:50873893-50873915 AGCAGCAGGGTGGGGGTCAGTGG + Intergenic
1109308701 13:60667015-60667037 ATCAGGTGGCTGTAGGTGTGTGG + Intergenic
1110314567 13:74091020-74091042 AGCATAAGGATGTAGGTCAATGG + Intronic
1110509648 13:76334560-76334582 AGCAACAGGCTGTAAGACAGAGG + Intergenic
1111178848 13:84635820-84635842 AGGAGGAGGCTGTAGGTGGGTGG - Intergenic
1112589548 13:100750728-100750750 GGCAGGAGACTGGAGGTAAGTGG - Intergenic
1116312000 14:43339336-43339358 AGCAGGAGGCTATAGGAAACTGG + Intergenic
1117781512 14:59237762-59237784 AGCAGGAGCCAGTAGGTCAGTGG + Intronic
1118001406 14:61526870-61526892 ACAAGGAGGCTGCAGGTCACGGG - Intronic
1118326821 14:64786860-64786882 AGAAGGAGGATATTGGTCAGCGG - Exonic
1119719956 14:76883841-76883863 TGGAGGAGGCTGCAGGTCTGAGG + Intergenic
1121037201 14:90716154-90716176 AGAAGGAGGGTGGGGGTCAGTGG + Intronic
1121324743 14:93013375-93013397 AGGTGGAGGCTGTGGGCCAGAGG - Intronic
1122784597 14:104157913-104157935 AGAAGGAGGCTGCAGCTGAGGGG - Exonic
1122818104 14:104323965-104323987 AGCAGGTAGCTGTCTGTCAGCGG - Intergenic
1122932519 14:104940946-104940968 CTCTGGAGGCTGCAGGTCAGTGG + Exonic
1124491946 15:30163617-30163639 AGAAGGAGGCTCTCGGTCAAAGG + Intergenic
1124751591 15:32374700-32374722 AGAAGGAGGCTCTCGGTCAAAGG - Intergenic
1126133306 15:45365555-45365577 AGTAGGAGGCTGCAGGTGAAGGG + Intronic
1127286679 15:57539279-57539301 GGCAGGAGCCTGTAGCTCAAAGG - Intronic
1127795692 15:62436482-62436504 AGCAGGTGGCAGGATGTCAGTGG + Intronic
1127800296 15:62471877-62471899 AGCAGGAGGATGGGGGGCAGAGG + Intronic
1128512055 15:68319405-68319427 AGCAGGAGCCTGTTGGGCAGAGG + Intronic
1129168676 15:73794483-73794505 AGCAGGGAGGTGTAGCTCAGGGG + Intergenic
1129219386 15:74122706-74122728 AGCAAGAGACTGAAGGTCTGAGG + Intronic
1129794186 15:78363482-78363504 AGCAGGAGGCTGAAGCTGAGAGG + Intergenic
1130051934 15:80490919-80490941 AACAGGAGGCTATGGGACAGGGG + Intronic
1131570872 15:93534934-93534956 TTGAGGAGCCTGTAGGTCAGGGG + Intergenic
1132478015 16:152309-152331 AGGAGGAGGCAGCAGGTCCGGGG - Intergenic
1132558447 16:582889-582911 ACCACGCGGCTGTAGGGCAGTGG - Exonic
1136134097 16:28244079-28244101 ATCAGGAGGCTTCAGGTGAGAGG + Intergenic
1139360665 16:66397856-66397878 AGGAGGAGGCTGTGGAACAGAGG - Intronic
1139371127 16:66470078-66470100 AGAGTGAGGCTGAAGGTCAGAGG + Intronic
1139444283 16:66987311-66987333 AGCAAGAGGCTGTGGGCCAAGGG + Intergenic
1139656175 16:68388387-68388409 AGCAAGAGGGTGAAGGACAGAGG - Intronic
1140133474 16:72184346-72184368 TGCAGAAGCCTGTGGGTCAGTGG - Intergenic
1140835606 16:78791115-78791137 AGAAGGGGGTTGGAGGTCAGTGG + Intronic
1141093126 16:81144036-81144058 GGGAGGAGGCTGTGAGTCAGAGG - Intergenic
1141930843 16:87201760-87201782 GGCAGGAGCTTGGAGGTCAGAGG - Intronic
1142415547 16:89939181-89939203 AGCAAGAGGCTGGAGGGCGGAGG - Intergenic
1142440956 16:90097208-90097230 AGCCAAAGGCTCTAGGTCAGAGG - Intergenic
1142808342 17:2383455-2383477 AAGAAGAGGCTGGAGGTCAGGGG - Intergenic
1142878298 17:2865801-2865823 AGAAGGGGGCTGGGGGTCAGAGG - Intronic
1142964841 17:3574010-3574032 AGCAGGAGGGTGTATGTCAGGGG - Intronic
1143758189 17:9081727-9081749 GGCAGGAGGCTGGGGGTCAGGGG + Intronic
1144549121 17:16224173-16224195 AGCAAGAGGCTGGAGTGCAGTGG - Intronic
1144566602 17:16364517-16364539 AGAAGCAGGGTGGAGGTCAGTGG + Intergenic
1144888587 17:18480290-18480312 AGCAGGAGGATCAAAGTCAGAGG - Intronic
1145125613 17:20297746-20297768 TGTAGGAGGTTCTAGGTCAGGGG - Intronic
1145143619 17:20464008-20464030 AGCAGGAGGATCAAAGTCAGAGG + Intronic
1146567187 17:33923630-33923652 AGAAGGAGGCTGTGGGGCCGGGG + Intronic
1147119456 17:38327338-38327360 AGCAGGAGGCTGTGTGTCCCTGG - Exonic
1147336053 17:39727523-39727545 GGCTGGGGGCTGCAGGTCAGGGG - Exonic
1147609403 17:41792834-41792856 AGCAGGAGGCTGCAGGGCTCTGG + Intergenic
1148024620 17:44578039-44578061 GGCAGGAGGGAGTAGATCAGGGG - Intergenic
1149000000 17:51747715-51747737 AGCCGGTGGCTGTATGTCATGGG + Exonic
1149571432 17:57675142-57675164 AGGAGGAGGCAGGAGGGCAGGGG - Intronic
1151480577 17:74368240-74368262 AGCAGGAGGCTAGGGGTGAGAGG - Intronic
1151805880 17:76405122-76405144 CGGAGGAGGCTGTAGCCCAGAGG + Intronic
1152331928 17:79678488-79678510 AGCAGAAGGCTGGGCGTCAGGGG + Intergenic
1152598862 17:81251464-81251486 GGCAGGCGGCTGTAGGGCGGAGG + Intronic
1152884405 17:82840884-82840906 AGCCTGAGGCTGCAGGGCAGAGG + Intronic
1153322408 18:3786066-3786088 GGCAGGAGGGTCTGGGTCAGGGG - Intronic
1153575091 18:6512047-6512069 TGCTGGAGGCTGTAGGTCAGAGG - Intronic
1155362466 18:25016408-25016430 GGCAGGAGGCTGGAGGTAGGAGG + Intergenic
1155429734 18:25742830-25742852 AGCAGCAGGCTGCAGCTCAGGGG + Intergenic
1155433136 18:25782943-25782965 AGCAGGAGGCTCAGGGGCAGGGG - Intergenic
1155899260 18:31367843-31367865 AGCAGATGGCTGTAGGTGTGTGG - Intergenic
1157195797 18:45619298-45619320 AGCAGGAGGCACAAGGGCAGAGG - Intronic
1157713232 18:49864253-49864275 AGCAGGAGGCTGTAGCTATCTGG + Exonic
1159827134 18:73227252-73227274 GGCTGGAGTCTGTAGGACAGTGG - Intronic
1161083940 19:2325316-2325338 TGCAGGAGCCTGCAGGGCAGTGG - Intronic
1161171196 19:2813226-2813248 AGCAAGGGGCTGCAGGTCGGGGG + Exonic
1161490750 19:4559888-4559910 CACAGGAGGCTGTAGAGCAGGGG - Intergenic
1161586323 19:5107724-5107746 AGCAGGAGGCTGCTGCTAAGGGG + Intronic
1161704633 19:5813632-5813654 AGCTGGAGGCTGGAGTGCAGTGG - Intergenic
1161924234 19:7289303-7289325 GGGTGGAGGCTGGAGGTCAGTGG + Intronic
1161991989 19:7689435-7689457 AGCAAAAGGCTTTGGGTCAGGGG + Intronic
1162075695 19:8185544-8185566 AGCAGGTCACTATAGGTCAGTGG - Intronic
1162736038 19:12747673-12747695 GGCAGGAGGCTAGAGGGCAGAGG - Intronic
1163494904 19:17640674-17640696 AGCAGGAGGCACTAGGCCAGGGG + Intronic
1163679756 19:18674212-18674234 ACAAGGAGACTGGAGGTCAGAGG + Intergenic
1164698122 19:30262191-30262213 AGCAGGAGACTCCAGGTGAGAGG + Intronic
1165420896 19:35721374-35721396 AGGAGGAGGCTCTGGCTCAGGGG - Exonic
1165976517 19:39681337-39681359 TGCAGGAGGCTAGAGGTCAAAGG - Intergenic
1166073110 19:40397989-40398011 GGCAGGAGGCGGTGGGACAGTGG + Intronic
1166106575 19:40600830-40600852 GGCAGGAGGCTGGAGGTGGGGGG - Intronic
1167468127 19:49660916-49660938 AGCAGAGGGCCTTAGGTCAGGGG - Intronic
1168059424 19:53882864-53882886 AGGAGGAGGCTGGAGGACAGAGG + Intronic
924976214 2:178035-178057 TGCAGAAGGGAGTAGGTCAGGGG + Intergenic
925051801 2:821344-821366 AGCACCAGGCTCTAGTTCAGTGG + Intergenic
925208694 2:2028298-2028320 AGCAGGAGGCTGTGGGATTGTGG + Intronic
926111313 2:10185939-10185961 AGCAGTAGGCTGCTGGACAGAGG + Intronic
926435522 2:12833927-12833949 CTAAGGAGGCTGAAGGTCAGAGG - Intergenic
926717785 2:15938954-15938976 AGGAGGATGCTGAGGGTCAGGGG - Intergenic
927064810 2:19460664-19460686 AGGAGCAGGGTGGAGGTCAGAGG - Intergenic
927215045 2:20663660-20663682 AGCTGGAGTCTGGAGGTCTGGGG + Intergenic
927357328 2:22188041-22188063 AGCAGTAGGTCGCAGGTCAGAGG - Intergenic
928433555 2:31239415-31239437 AGCAGAAGGCCTTAGGCCAGAGG + Intronic
930179978 2:48345341-48345363 AGGAGGAGGGTGTAGGGAAGGGG + Intronic
930771512 2:55134717-55134739 CTCAGGGGGCTGCAGGTCAGAGG - Intergenic
931677678 2:64713905-64713927 AGCAGGTGGCTCTGGGCCAGGGG + Intronic
932306998 2:70711131-70711153 ACCAGGATGCTGAAGATCAGAGG + Intronic
932806437 2:74787696-74787718 ATCAGGTGGCTGTAGGTGTGTGG + Intergenic
933014174 2:77103165-77103187 AGCAGCAGACTGTGGTTCAGAGG + Intronic
937770312 2:125713151-125713173 AGAAGGAGGCTGTGGGTCACTGG + Intergenic
940027581 2:149224698-149224720 AGCAAGAGGCTGCAAGTCCGGGG + Intergenic
941869974 2:170373677-170373699 AGCAAGAGGGAGTGGGTCAGGGG + Intronic
941934111 2:170970045-170970067 AGCTGGGGGCTGCAGGTGAGGGG + Intergenic
942278233 2:174337615-174337637 AGCGGGAGGCGGGAGGGCAGGGG + Exonic
944366984 2:198932544-198932566 AACAGGAAGCTGTGGGACAGAGG + Intergenic
944789200 2:203107034-203107056 ATGAGGAGACTGTAGGTAAGAGG - Intronic
945726894 2:213481562-213481584 AGCAGGATTCAGGAGGTCAGGGG - Intronic
946152636 2:217786743-217786765 ATCAGCAGGATGTAGGTGAGGGG - Intergenic
947667737 2:231917866-231917888 AGCAGGAGGCTGGAAGGGAGGGG + Intergenic
948615945 2:239199087-239199109 GGCAGGAAGCAGGAGGTCAGGGG - Intronic
949007150 2:241656189-241656211 AGGAGCAGGCTGTGGGTGAGGGG - Intronic
1168794720 20:603893-603915 AGCTGGTGGCTGGAGGACAGGGG + Exonic
1168978569 20:1986329-1986351 AGCTGGAGGCTGGAGATGAGAGG - Intronic
1169009556 20:2238785-2238807 ATCAGGAGGCTGGAGATGAGAGG + Intergenic
1169126099 20:3127915-3127937 AACAGGAGGCTTTAGGCCAGGGG - Intronic
1169837667 20:9898567-9898589 GGCAGGAGGCAGTGGGTCAGTGG + Intergenic
1170663726 20:18366859-18366881 AGGAGCAGGGTGGAGGTCAGTGG + Intergenic
1170941981 20:20855657-20855679 AGCAGGAGGAAGAAGGTGAGAGG + Intergenic
1171453453 20:25252530-25252552 CTGAGGAGGCTGTCGGTCAGAGG - Intronic
1172271463 20:33657849-33657871 ACCAGGAGGCTGGGGGTCAGAGG + Exonic
1172649643 20:36493607-36493629 AGCAGGATGCTGTAGGGATGTGG + Intronic
1172785121 20:37463746-37463768 AGGAGGAAGCTGCAGTTCAGAGG - Intergenic
1172814691 20:37677072-37677094 AGCAGGGGGCTGCAGGTGTGTGG + Intergenic
1173678784 20:44861455-44861477 AAGAGGAGGCTGAAGTTCAGGGG - Intergenic
1173733463 20:45343898-45343920 ACCAGGAGGCTGGGGCTCAGAGG + Intronic
1173863667 20:46300373-46300395 AGCAGGTGGATCCAGGTCAGTGG - Intronic
1173939702 20:46899748-46899770 ACCAGCAGGCTGCGGGTCAGTGG + Intronic
1174087386 20:48018823-48018845 GGCAAGAGGGTGCAGGTCAGAGG - Intergenic
1175695572 20:61100628-61100650 AGCATGAGGCTGTGGGTTGGTGG + Intergenic
1177191407 21:17855955-17855977 AGAAGCAGGCTTGAGGTCAGGGG - Intergenic
1179344492 21:40544111-40544133 AGCAGGAGTCAGGAGGGCAGGGG + Intronic
1179558483 21:42195628-42195650 AGCAGCAGGCTGTGGGTGAGAGG + Intergenic
1179679976 21:43012518-43012540 AGCTGGAGGCTGAAGTGCAGTGG - Intronic
1180050180 21:45327499-45327521 AGGAGGAGGCTGCCGGGCAGAGG + Intergenic
1180068724 21:45425512-45425534 TGCAGGAGGGTGTGGGTGAGTGG - Intronic
1180988140 22:19917603-19917625 AGGAGAAGGTTGTAGGCCAGGGG + Intronic
1181126018 22:20702853-20702875 AGCAGGCAGCTGCAGGGCAGTGG + Intergenic
1181640043 22:24191508-24191530 AGTGGGAGGCTGGAGGGCAGGGG - Intergenic
1182321826 22:29482665-29482687 AGCTGGAGGCTGCAGGTTTGTGG - Intronic
1182679590 22:32068317-32068339 AGCAAATGGCTGGAGGTCAGGGG + Intronic
1182787641 22:32920826-32920848 AGCAGGAGACTGGAAGGCAGAGG + Intronic
1183520009 22:38291415-38291437 AGGAGGAGCCTGGAGGCCAGGGG + Exonic
1184224846 22:43123709-43123731 TGCTGGAGGCTGGAGGGCAGTGG - Intronic
1184258120 22:43298592-43298614 AGCAGGGGGCGGCAGGGCAGCGG - Intronic
1184450393 22:44579065-44579087 GGCTGGGGGCTGTAGTTCAGAGG - Intergenic
1184892811 22:47389946-47389968 TGCAGGAAGATGGAGGTCAGCGG - Intergenic
949749673 3:7337113-7337135 AGCAGTTGGCTGTAAGTAAGTGG - Intronic
951578078 3:24133965-24133987 AACTGGAGTCTGTAGGGCAGAGG - Intronic
951658476 3:25035850-25035872 AGCAGGTGGGTGTAGACCAGTGG - Intergenic
951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG + Intergenic
952072149 3:29650328-29650350 AGCTGGAGGCTGGAGTGCAGTGG + Intronic
952203316 3:31152787-31152809 ACCAGGAGGCTGGAGTGCAGTGG - Intergenic
952882358 3:37992723-37992745 CGGAGGAGGCTGTGGGGCAGGGG - Intronic
953694194 3:45145488-45145510 GGCAGGAGGCTGTTGTTCCGGGG - Intronic
953821851 3:46213837-46213859 ATGAGGAGGCTGAAGGTCAGTGG - Intronic
953856385 3:46502626-46502648 AGCAGGTGTATGTATGTCAGAGG - Intergenic
954572045 3:51648969-51648991 AGCAGGCTTCTGAAGGTCAGTGG + Intronic
955550019 3:60073810-60073832 AGCTGGAGGTTGCAGGACAGAGG - Intronic
955655894 3:61244533-61244555 AGCAGAAGCCAGAAGGTCAGAGG + Intronic
956426822 3:69144709-69144731 GGCAGGAGGCAGGAGGTCTGTGG + Intergenic
956732838 3:72212698-72212720 AGAAGGGGACTGTAGGTCTGGGG - Intergenic
959621052 3:108398766-108398788 AGCAGGTGGCTGTGGCTGAGCGG - Exonic
960768440 3:121164897-121164919 AACAGGGAGATGTAGGTCAGAGG + Intronic
961606532 3:128099578-128099600 CGCAGGAGGATGCAGGTGAGTGG - Intronic
962383488 3:134914903-134914925 AGCAGGAGCCTATAGGACATGGG - Intronic
962856909 3:139355249-139355271 AGCAGGAGGGTGGTGGTCACAGG - Intronic
963008103 3:140745074-140745096 AGCAGAAGGCTTTGGGTAAGAGG + Intergenic
964811899 3:160674029-160674051 AGTTGGTGGCTCTAGGTCAGAGG - Intergenic
968049324 3:195643316-195643338 ACCAGCAGGCTGGAGCTCAGTGG + Intergenic
968098078 3:195946308-195946330 ACCAGCAGGCTGGAGCTCAGCGG - Intergenic
968106583 3:196005824-196005846 ACCAGCAGGCTGGAGCTCAGCGG - Intergenic
968305293 3:197646616-197646638 ACCAGCAGGCTGGAGCTCAGCGG - Intergenic
968361220 3:198148195-198148217 AGCCAAAGGCTCTAGGTCAGAGG - Intergenic
968505632 4:970096-970118 AGCAGGAGGCCTTAGGCCGGTGG - Intronic
968853758 4:3102939-3102961 GGCAGCAGGCTCTGGGTCAGGGG + Intronic
969315998 4:6381595-6381617 AGCAGGAGTCTGAAGGAGAGGGG - Intronic
969343318 4:6556055-6556077 CGCAGGAGGCTCTCGGTCACAGG - Intronic
969592502 4:8130064-8130086 AACAGCAGGCTGGAGGCCAGGGG - Intronic
971689335 4:29812474-29812496 TGCTGGAGGCTGTAGGGGAGGGG + Intergenic
975223620 4:71843372-71843394 AGTAGCAGGGTGGAGGTCAGTGG + Intergenic
976362634 4:84197643-84197665 AGCAGGAGGCTGCAGCTCATTGG - Intergenic
976549943 4:86382181-86382203 AGCAGGTGGTTGTATCTCAGTGG - Intronic
976874298 4:89836027-89836049 AGCTGGAGGCTTAGGGTCAGGGG + Intronic
978524861 4:109655028-109655050 CACAGGAGGCTGTAAATCAGGGG + Intronic
980980688 4:139652252-139652274 GGCAGGAGGGTGCAGGTCATGGG + Intergenic
981271438 4:142850734-142850756 TTCAGGAGGCTGTAAGTCAAAGG + Intergenic
982205564 4:152995158-152995180 AGCAGGAGGCTGAGGCCCAGAGG + Intergenic
983644553 4:169976714-169976736 AGCAGCGGGGTGCAGGTCAGTGG + Intergenic
984947335 4:184980038-184980060 AGCAGCAGGCTGCAGGCCCGGGG - Intergenic
985505883 5:280156-280178 ACCAGCAGGCTGGAGCTCAGCGG + Intronic
985742314 5:1625770-1625792 ACCAGCAGGCTGGAGCTCAGCGG - Intergenic
986624972 5:9715405-9715427 ACCAGGAGGCTGTGGGTATGAGG + Intergenic
986670502 5:10139259-10139281 AGGAGGAGGGTTCAGGTCAGGGG - Intergenic
987342679 5:16952551-16952573 AGCTGGAGGCCATAGGTCAATGG - Intergenic
988283163 5:29175883-29175905 AGCAGCAGGCTGGAGATCAGGGG - Intergenic
991446190 5:66702602-66702624 AGCAGGAGGCTTTCAGGCAGAGG + Intronic
991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG + Intergenic
992002917 5:72452654-72452676 AGCAGAAGGCTGAAGGCCAGAGG - Intronic
995109846 5:108417101-108417123 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
996152831 5:120061165-120061187 AGCAGGAGCCTCTAAGACAGAGG - Intergenic
996650316 5:125867938-125867960 AGCAGGAAGCTGGAGGTAAATGG + Intergenic
999494643 5:152085126-152085148 ACCAGGAGGCTGTGGATCAGTGG + Intergenic
999586002 5:153090187-153090209 AACAAGAGGGTATAGGTCAGGGG + Intergenic
1000103807 5:158039768-158039790 AGCAGGAGACTATGGGTGAGAGG + Intergenic
1001196318 5:169676426-169676448 AGCACAGGGCTATAGGTCAGAGG - Intronic
1001658982 5:173376303-173376325 AGCAGGAAGCTGAAGGTGAGTGG + Intergenic
1001749622 5:174118675-174118697 TGCATGTGGCTGGAGGTCAGTGG - Intronic
1001918585 5:175582470-175582492 ATCTGGAGGCTGGTGGTCAGTGG - Intergenic
1002761506 6:205978-206000 AGCAGGAGGCTGGAGTCTAGAGG - Intergenic
1002917157 6:1538586-1538608 AGCAGGTGGCTGTGGGTGAGGGG - Intergenic
1003024669 6:2543528-2543550 AGCAGGAGCCTGGAGGGCTGTGG - Intergenic
1003441857 6:6150188-6150210 AGCAGGGGGCTGTATGGAAGAGG + Intronic
1003538959 6:7001564-7001586 AGCAGGAGGCTGTTGGCCTGAGG - Intergenic
1005206814 6:23414456-23414478 AGCAGTAGGCTGGTGGCCAGTGG - Intergenic
1005328179 6:24721788-24721810 AGGGGCAGGCTGTAGGTCTGAGG - Intergenic
1005737152 6:28758418-28758440 AGGAGGGGGGTGTAGCTCAGTGG - Intergenic
1006430445 6:33992724-33992746 AGCAGGAGGGTGAGGGTCTGGGG - Intergenic
1006730514 6:36232834-36232856 AGGAGGAGGCTGTAGGGAATGGG - Intergenic
1006918849 6:37614535-37614557 AGAAGGAGGGTGTGGGTTAGAGG - Intergenic
1007668491 6:43531644-43531666 AGCAGGAAGCTGTTGTTCAGGGG + Intronic
1007813820 6:44505961-44505983 AGCAGGAGGCTAGGGGTGAGGGG + Intergenic
1008994335 6:57641082-57641104 AGCAGAAGGTTGTAGATCTGTGG - Intronic
1010158445 6:72822949-72822971 AGCAGGAGGGTCCAAGTCAGAGG - Intronic
1010832841 6:80552168-80552190 AGCAGGAAACAGGAGGTCAGTGG + Intergenic
1012678406 6:102146825-102146847 ATCAGATGGCTGTAGGTGAGCGG - Intergenic
1013172092 6:107645945-107645967 AGCATGAGGCTGGAGGAGAGTGG + Intronic
1014450679 6:121577955-121577977 AGGAGCAGGCTGGAGGTCAGTGG + Intergenic
1015188397 6:130445223-130445245 AGTAGGTGGATGTATGTCAGTGG - Intergenic
1015937743 6:138419885-138419907 AGCAGCAGACTGTAGTTCAATGG - Exonic
1017975851 6:159356692-159356714 AGCAAGGGGCAGTGGGTCAGAGG - Intergenic
1019960230 7:4452943-4452965 AGAAGGAGGTTGTAGGTGAGAGG - Intergenic
1021762084 7:23912089-23912111 AGTAACAGGCTGCAGGTCAGGGG + Intergenic
1023843010 7:44107270-44107292 AGCAGGATGCTGAAGGCCAGAGG + Intronic
1024109963 7:46134691-46134713 GGCAGGAGGAGGTAGGCCAGGGG + Intergenic
1024312671 7:47983750-47983772 AGCAGGAGCATGTGGGTCACTGG - Intergenic
1024655814 7:51450623-51450645 TGTAGGAGGCAGGAGGTCAGAGG + Intergenic
1024760519 7:52591228-52591250 AGCTGAAGGCAGTAGTTCAGGGG + Intergenic
1025005977 7:55355233-55355255 AGGAGCAGGGTGGAGGTCAGTGG + Intergenic
1025022139 7:55488448-55488470 AGCAGGAGGCTGAGGTTCAGAGG - Intronic
1025025765 7:55515056-55515078 AGCAGCAGGCTGGAGGTGACAGG - Intronic
1026197737 7:68187415-68187437 GGCTGGAGGCTGGAGGGCAGTGG - Intergenic
1026945459 7:74313263-74313285 AGCTGGAGGCTGGAGTGCAGTGG - Intronic
1028389390 7:90296773-90296795 AGCAGGAGTTTACAGGTCAGAGG + Intronic
1028413381 7:90554973-90554995 ATCAGGTGGCTGTAGGTGTGTGG - Intronic
1028431663 7:90754323-90754345 ATCAGGTGGCTGTAGGTGTGTGG - Intronic
1029620950 7:101689367-101689389 AGAAGGCAGCTGTAGGACAGTGG - Intergenic
1029656215 7:101926467-101926489 AGCAGGGGCCTGTAGGGAAGAGG + Intronic
1030223676 7:107125574-107125596 AGCAGGTGGCTGCAGTACAGAGG + Intronic
1032128048 7:129208926-129208948 GGCAGGATGCAGTAAGTCAGTGG + Intronic
1032916700 7:136498231-136498253 AGTGGGAGGCTGGATGTCAGGGG - Intergenic
1034241917 7:149617386-149617408 AGCAGGAGGCGGTTGGGGAGTGG + Intergenic
1035406802 7:158604123-158604145 AGCAGGTGGGTGTGGGGCAGAGG - Intergenic
1035600723 8:895430-895452 AGCAGGGGGCTGTCGGTCTCTGG + Intergenic
1036897849 8:12650126-12650148 AGAAGGGAGCTGTGGGTCAGCGG - Intergenic
1038617165 8:29105439-29105461 CACAGGAGGCTGCAGGGCAGAGG - Intronic
1039862761 8:41473123-41473145 GGCAGGATGCTGGAGGTCAAAGG + Intergenic
1040008698 8:42642893-42642915 AGCAGCAGGGGGCAGGTCAGGGG - Intergenic
1042592146 8:70406009-70406031 AGCAAGAGCCTGAAGTTCAGAGG - Intergenic
1043342252 8:79254427-79254449 AGCAGCAGGGTGGAGGTCAGTGG + Intergenic
1044086539 8:87949326-87949348 AGCAGATGGCTGTAGGTGTGTGG - Intergenic
1044291480 8:90475819-90475841 ATCAGGAGGCAGGAGGTCATGGG - Intergenic
1044560303 8:93606054-93606076 AGCAGGAGGGAGGAGGCCAGTGG + Intergenic
1044619070 8:94171701-94171723 AACAGTAGTCTGTACGTCAGAGG - Intronic
1046522361 8:115341919-115341941 GGCTGGAGGCTGGAGGGCAGTGG + Intergenic
1048720850 8:137322631-137322653 AGGAGGATGGTGTGGGTCAGGGG + Intergenic
1049266632 8:141671169-141671191 AGCAGGAGGCAGGAGGTGAGTGG - Intergenic
1049509994 8:143022527-143022549 AGCAGCTGGCTGTGGCTCAGGGG - Intronic
1049618314 8:143586181-143586203 AGCAGGAGCCCGCAGGTCCGTGG + Intronic
1049711189 8:144064105-144064127 CTCAGGGGGCTGGAGGTCAGAGG - Intergenic
1051131307 9:13864255-13864277 AGCAGCCAGCTGTAAGTCAGGGG + Intergenic
1052008067 9:23374458-23374480 ATCACGAGGCTGGAAGTCAGAGG + Intergenic
1052026122 9:23575262-23575284 AGGAGGAGGCTTTAGATCTGGGG - Intergenic
1052129669 9:24827899-24827921 ATCAGATGGCTGTAGATCAGTGG - Intergenic
1053125181 9:35575320-35575342 AGCAAGAGGCAGCAAGTCAGTGG + Intergenic
1059546792 9:115183904-115183926 AGCAGGGGGCTGTTGGGGAGGGG - Intronic
1060208572 9:121697091-121697113 AGGAGGAGGCTGCTTGTCAGAGG + Intronic
1060238603 9:121884445-121884467 GGCAGGACGGGGTAGGTCAGTGG - Intronic
1060629562 9:125143427-125143449 AGCAGGAGCCGGATGGTCAGAGG - Exonic
1061084058 9:128389201-128389223 GGCAGGAGGCAGTAGCACAGAGG - Intronic
1061416817 9:130451569-130451591 AGAAGGATGCTGTGGGGCAGGGG - Intronic
1061507674 9:131040710-131040732 AGCAGGAGGCTGTGAGCCACAGG - Intronic
1061933329 9:133844457-133844479 GGGAGGAGGCTCTAGGACAGGGG + Intronic
1061981255 9:134104733-134104755 AGCTGGAGGCATTAGGTGAGTGG - Intergenic
1062165344 9:135104801-135104823 AGCAGGAGGCAGGAGGTGGGAGG - Intronic
1062733284 9:138120936-138120958 GGCAGGAGCCTGTGGGACAGGGG - Intronic
1185778928 X:2829184-2829206 CGCAGGGGGCTGGAGGTCAGAGG + Intronic
1187239821 X:17502301-17502323 AGCAGGAGAGTGAAGGGCAGTGG + Intronic
1187684237 X:21800528-21800550 CCCAGCAGACTGTAGGTCAGGGG + Intergenic
1188725528 X:33577898-33577920 AGCAGGGGGCTGTTGGGCATGGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1190379460 X:49825925-49825947 AGACCGAGGCTGTGGGTCAGAGG - Intergenic
1191668265 X:63725237-63725259 AGGAGGAGGCTGCAGGACTGGGG - Intronic
1192207190 X:69104310-69104332 AGCAGGAGGCTGTACCTCTTTGG + Intergenic
1192209781 X:69120494-69120516 GGCAGGAGGATGGAGGTCATAGG - Intergenic
1192770595 X:74185601-74185623 ATCAGGAGGCTGAGGGCCAGTGG + Intergenic
1194227203 X:91275595-91275617 ATCAGAAGGCTGTAAGTAAGTGG - Intergenic
1194980410 X:100434547-100434569 AGCAGGAGGATGCAGGATAGAGG - Intergenic
1195483412 X:105374146-105374168 AGCAGATGGCTGTAGGTGTGTGG + Intronic
1196752463 X:119130246-119130268 AGCATGGGGCTGTGAGTCAGGGG - Intronic
1197200444 X:123744101-123744123 AGCAAGAAACTGTAGGTCTGTGG - Intergenic
1198561780 X:137858240-137858262 AACAGGAGGCTGGGGGCCAGTGG + Intergenic
1198992629 X:142532894-142532916 AGCAGGAAAATGTAGGTAAGGGG - Intergenic
1199582561 X:149374978-149375000 AGAAGGAAGCTGAAGCTCAGAGG - Intergenic
1199622978 X:149715534-149715556 AGCAGGAGGCTCCAGGACTGAGG - Intronic