ID: 991503159

View in Genome Browser
Species Human (GRCh38)
Location 5:67297715-67297737
Sequence AACATCACTGATGGGTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991503159_991503164 -4 Left 991503159 5:67297715-67297737 CCCCATTACCCATCAGTGATGTT No data
Right 991503164 5:67297734-67297756 TGTTTCCAGTACCAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991503159 Original CRISPR AACATCACTGATGGGTAATG GGG (reversed) Intergenic
No off target data available for this crispr