ID: 991510854

View in Genome Browser
Species Human (GRCh38)
Location 5:67375185-67375207
Sequence CTCAGCCAGCACAACTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991510852_991510854 -9 Left 991510852 5:67375171-67375193 CCTGTTTGCAGAATCTCAGCCAG No data
Right 991510854 5:67375185-67375207 CTCAGCCAGCACAACTATCTGGG No data
991510851_991510854 -4 Left 991510851 5:67375166-67375188 CCTTTCCTGTTTGCAGAATCTCA No data
Right 991510854 5:67375185-67375207 CTCAGCCAGCACAACTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991510854 Original CRISPR CTCAGCCAGCACAACTATCT GGG Intergenic
No off target data available for this crispr