ID: 991511493

View in Genome Browser
Species Human (GRCh38)
Location 5:67382047-67382069
Sequence AACTAGTTCTGTAGCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991511492_991511493 -4 Left 991511492 5:67382028-67382050 CCACATGCAATTAAAATAAAACT No data
Right 991511493 5:67382047-67382069 AACTAGTTCTGTAGCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991511493 Original CRISPR AACTAGTTCTGTAGCAAAGA AGG Intergenic
No off target data available for this crispr