ID: 991515428

View in Genome Browser
Species Human (GRCh38)
Location 5:67429632-67429654
Sequence ACAATGCCCCAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991515428_991515432 23 Left 991515428 5:67429632-67429654 CCTCTCTTCTTCTGGGGCATTGT No data
Right 991515432 5:67429678-67429700 CTGCCTCTCTTCTCTCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991515428 Original CRISPR ACAATGCCCCAGAAGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr