ID: 991516264

View in Genome Browser
Species Human (GRCh38)
Location 5:67438979-67439001
Sequence AGATGTACCTGGGGAATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991516259_991516264 -10 Left 991516259 5:67438966-67438988 CCAGCATCAAATGAGATGTACCT No data
Right 991516264 5:67438979-67439001 AGATGTACCTGGGGAATTGGAGG No data
991516258_991516264 -7 Left 991516258 5:67438963-67438985 CCTCCAGCATCAAATGAGATGTA No data
Right 991516264 5:67438979-67439001 AGATGTACCTGGGGAATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991516264 Original CRISPR AGATGTACCTGGGGAATTGG AGG Intergenic
No off target data available for this crispr