ID: 991523059

View in Genome Browser
Species Human (GRCh38)
Location 5:67522454-67522476
Sequence AAGCATAGCCTACATTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991523059_991523061 14 Left 991523059 5:67522454-67522476 CCACAGCAATGTAGGCTATGCTT No data
Right 991523061 5:67522491-67522513 GCATTGCTAATAGAACAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991523059 Original CRISPR AAGCATAGCCTACATTGCTG TGG (reversed) Intergenic
No off target data available for this crispr