ID: 991527919

View in Genome Browser
Species Human (GRCh38)
Location 5:67583343-67583365
Sequence CTGGGGAGGCTGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991527919_991527928 12 Left 991527919 5:67583343-67583365 CCTTCCTGCTTCAGCCTCCCCAG No data
Right 991527928 5:67583378-67583400 CAGGCATGCACCACCACGCCTGG 0: 2909
1: 15371
2: 41698
3: 105256
4: 196462
991527919_991527924 -7 Left 991527919 5:67583343-67583365 CCTTCCTGCTTCAGCCTCCCCAG No data
Right 991527924 5:67583359-67583381 TCCCCAGTAGCTGGGATTACAGG 0: 4041
1: 105745
2: 255148
3: 237172
4: 465214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991527919 Original CRISPR CTGGGGAGGCTGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr