ID: 991531378

View in Genome Browser
Species Human (GRCh38)
Location 5:67618932-67618954
Sequence CTGAACTACCTTTCAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991531373_991531378 0 Left 991531373 5:67618909-67618931 CCATTTCCTCAGCCTTGGAATCC No data
Right 991531378 5:67618932-67618954 CTGAACTACCTTTCAGCTCCAGG No data
991531374_991531378 -6 Left 991531374 5:67618915-67618937 CCTCAGCCTTGGAATCCCTGAAC No data
Right 991531378 5:67618932-67618954 CTGAACTACCTTTCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991531378 Original CRISPR CTGAACTACCTTTCAGCTCC AGG Intergenic
No off target data available for this crispr