ID: 991540900

View in Genome Browser
Species Human (GRCh38)
Location 5:67726982-67727004
Sequence AAGTATAAGTTCTTGAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991540899_991540900 -2 Left 991540899 5:67726961-67726983 CCTTCTGTCACACTCAAAAGAAA No data
Right 991540900 5:67726982-67727004 AAGTATAAGTTCTTGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991540900 Original CRISPR AAGTATAAGTTCTTGAATTC TGG Intergenic
No off target data available for this crispr