ID: 991544511

View in Genome Browser
Species Human (GRCh38)
Location 5:67766547-67766569
Sequence ATTTTCTACTGAGGAATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991544511_991544515 -2 Left 991544511 5:67766547-67766569 CCATTGATTCCTCAGTAGAAAAT No data
Right 991544515 5:67766568-67766590 ATAGAAGGCTTTCACACTGTGGG No data
991544511_991544514 -3 Left 991544511 5:67766547-67766569 CCATTGATTCCTCAGTAGAAAAT No data
Right 991544514 5:67766567-67766589 AATAGAAGGCTTTCACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991544511 Original CRISPR ATTTTCTACTGAGGAATCAA TGG (reversed) Intergenic
No off target data available for this crispr