ID: 991544979

View in Genome Browser
Species Human (GRCh38)
Location 5:67771693-67771715
Sequence GGGTGGGTATTTGGGAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991544969_991544979 29 Left 991544969 5:67771641-67771663 CCATTGAAAATACAACATGAACA No data
Right 991544979 5:67771693-67771715 GGGTGGGTATTTGGGAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991544979 Original CRISPR GGGTGGGTATTTGGGAGGTC GGG Intergenic
No off target data available for this crispr