ID: 991550220

View in Genome Browser
Species Human (GRCh38)
Location 5:67827301-67827323
Sequence GTGGATGGCTAGTTTAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991550220_991550225 -10 Left 991550220 5:67827301-67827323 CCACCACTAAACTAGCCATCCAC No data
Right 991550225 5:67827314-67827336 AGCCATCCACCCCCTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991550220 Original CRISPR GTGGATGGCTAGTTTAGTGG TGG (reversed) Intergenic
No off target data available for this crispr